1Probioticslab R&D Institute, Bioeleven Co., Seoul, Korea.
2Department of Pediatric, Samsung Medical Center, Sungkyunkwan University School of Medicine, Seoul, Korea.
3Department of Internal Medicine, Samsung Medical Center, Sungkyunkwan University School of Medicine, Seoul, Korea.
© Copyright 2018. Korean Association for the Study of Intestinal Diseases.
This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
FINANCIAL SUPPORT: This work was supported by the Bioeleven Co., Seoul, Korea.
CONFLICT OF INTEREST: No potential conflict of interest relevant to this article was reported.
AUTHOR CONTRIBUTION: S.Y.K. and S.K. designed the study; B.K., Y.H.C., and Y.H.K. collected samples; Y.K. performed the gut microbiota analysis; S.Y.K., Y.K., and S.K. analyzed the data and prepared the manuscript. All authors reviewed the manuscript.
Infant | Adult | P-value | |
---|---|---|---|
Total subjects | 164 | 214 | |
Male | 85 (51.83) | 94 (42.74) | |
Female | 79 (48.17) | 120 (57.26) | |
Age (yr) | 0.42±0.25 | 32.97±14.10 | <0.0001 |
Height (cm) | 65.04±8.37 | 159.80±24.04 | <0.0001 |
Weight (kg) | 7.29±2.30 | 55.20±16.23 | <0.0001 |
BMI (kg/m2) | 16.69±2.21 | 20.80±2.52 | <0.0001 |
Values are presented as number (%) or mean±SD. Significant differences between infants and adults were analyzed by t-test.
Target bacterial group | Primer | Primer sequence (5′→3′) | Predicted PCR product size (bp) | Annealing temperature (℃) |
---|---|---|---|---|
Lactobacillus genus | F | AGCAGTAGGGAATCTTCCA | 341 | 55 |
R | CACCGCTACACATGGAG | |||
Bifidobacterium genus | F | GGGTGGTAATGCCGGATG | 442 | 50 |
R | TAAGCGATGGACTTTCACACC | |||
Bacteroides genus | F | ATAGCCTTTCGAAAGRAAGAT | 495 | 60 |
R | CCAGTATCAACTGCAATTTTA | |||
Clostridium genus | F | CGGTACCTGACTAAGAAGC | 429 | 60 |
R | AGTTTYATTCTTGCGAACG | |||
Universal | F | TCCTACGGGAGGCAGCAGT | 467 | 60 |
R | GGACTACCAGGGTATCTAATCCTGTT |
F, forward; R, reverse; bp, base pairs.
Target bacterial group | Standard strain and strain number | qPCR efficiency (%) | Coefficient of determination (R)2 |
---|---|---|---|
Lactobacillus genus | Lactobacillus casei ATCC393 | 103.5 | 0.999 |
Bifidobacterium genus | Bifidobacterium animalis subsp. lactis JCM 10602 | 90.7 | 0.999 |
Bacteroides genus | Bacteroides fragilis ATCC 25285 | 96.9 | 0.997 |
Clostridium genus | Clostridium sphenoides ATCC19403 | 96.8 | 0.998 |
Universal | Lactobacillus casei ATCC393 | 101.6 | 0.999 |
qPCR, quantitative real-time PCR; ATCC, American Type Culture Collection; JCM, Japan Collection of Microorganism.
Values are presented as number (%) or mean±SD. Significant differences between infants and adults were analyzed by
F, forward; R, reverse; bp, base pairs.
qPCR, quantitative real-time PCR; ATCC, American Type Culture Collection; JCM, Japan Collection of Microorganism.