Skip Navigation
Skip to contents

Intest Res : Intestinal Research

IMPACT FACTOR

Articles

Page Path
HOME > Intest Res > Volume 15(3); 2017 > Article
Original Article NUDT15, FTO, and RUNX1 genetic variants and thiopurine intolerance among Japanese patients with inflammatory bowel diseases
Toshiyuki Sato1, Tetsuya Takagawa1,2, Yoichi Kakuta3, Akihiro Nishio1, Mikio Kawai1, Koji Kamikozuru1, Yoko Yokoyama1, Yuko Kita1, Takako Miyazaki1, Masaki Iimuro1, Nobuyuki Hida1, Kazutoshi Hori1,2, Hiroki Ikeuchi4, Shiro Nakamura1,2
Intestinal Research 2017;15(3):328-337.
DOI: https://doi.org/10.5217/ir.2017.15.3.328
Published online: June 12, 2017

1Division of Internal Medicine, Department of Inflammatory Bowel Disease, Hyogo College of Medicine, Nishinomiya, Japan.

2Department of Intestinal Inflammation Research, Hyogo College of Medicine, Nishinomiya, Japan.

3Division of Gastroenterology, Tohoku University Graduate School of Medicine, Sendai, Japan.

4Department of Inflammatory Bowel Disease Surgery, Hyogo College of Medicine, Nishinomiya, Japan.

Correspondence to Tetsuya Takagawa, Division of Internal Medicine, Department of Inflammatory Bowel Disease, Hyogo College of Medicine, 1-1 Mukogawa-cho, Nishinomiya 663-8501, Japan. Tel: +81-798-45-6663, Fax: +81-798-45-6790, takagawa@hyo-med.ac.jp
*These authors contributed equally to this study.
• Received: December 27, 2016   • Revised: February 15, 2017   • Accepted: February 24, 2017

© Copyright 2017. Korean Association for the Study of Intestinal Diseases.

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

prev next
  • 8,224 Views
  • 102 Download
  • 37 Web of Science
  • 35 Crossref
  • 43 Scopus
  • Background/Aims
    Recent genome-wide analyses have provided strong evidence concerning adverse events caused by thiopurine drugs such as azathioprine (AZA) and 6-mercaptopurine. The strong associations identified between NUDT15 p.Arg139Cys and thiopurine-induced leukopenia and severe hair loss have been studied and confirmed over the last 2 years. However, other coding variants, including NUDT15 p.Val18_Val19insGlyVal, NUDT15 p.Val18Ile, and FTO p.Ala134Thr, and a noncoding variation in RUNX1 (rs2834826) remain to be examined in detail in this respect. Therefore, we investigated the correlation between these adverse events and the 5 recently identified variants mentioned above among Japanese patients with inflammatory bowel diseases (IBD).
  • Methods
    One hundred sixty thiopurine-treated patients with IBD were enrolled. Genotyping was performed using TaqMan SNP Genotyping Assays or Sanger sequencing.
  • Results
    None of the 5 variants were associated with gastrointestinal intolerance to AZA. However, NUDT15 p.Arg139Cys was significantly associated with the interval between initiation and discontinuation of AZA among patients with gastrointestinal intolerance. This variant was strongly associated with early (<8 weeks) and late (≥8 weeks) leukopenia and severe hair loss. Moreover, it correlated with the interval between initiation of thiopurine therapy and leukopenia occurrence, and average thiopurine dose. NUDT15 p.Val18_Val19insGlyVal, NUDT15 p.Val18Ile, FTO p.Ala134Thr, and RUNX1 rs2834826 exhibited no significant relationship with the adverse events examined.
  • Conclusions
    Of the 5 variants investigated, NUDT15 p.Arg139Cys had the strongest impact on thiopurine-induced leukopenia and severe hair loss; therefore, its genotyping should be prioritized over that of other variants in efforts to predict these adverse events in Japanese patients with IBD.
The thiopurine drugs azathioprine (AZA) and 6-mercaptopurine (6-MP) have been used for many years for the treatment of numerous disorders, including UC, CD, acute lymphoblastic leukemia (ALL), and rheumatoid arthritis. In IBD (either UC or CD), thiopurines are used together with 5-aminosalicylic acid or the anti-tumor necrosis factor α antibodies infliximab and adalimumab to induce or maintain remission.12
Although thiopurine therapy has obvious clinical benefits in IBD, AZA and 6-MP occasionally induce severe adverse events such as leukopenia and alopecia. Thiopurine-induced severe leukopenia can result in infectious diseases with life-threatening consequences. Therefore, careful monitoring of white blood cell (WBC) count is required during treatment with these agents. Severe hair loss causes considerable stress to patients, and recovery may take more than 6 months following discontinuation of thiopurine therapy. These adverse events contribute to the interruption or discontinuation of thiopurine treatment. Therefore, genetic risk factors predictive of such thiopurine-induced effects have been studied in patients with IBD.3 Certain polymorphisms of thiopurine methyltransferase (TPMT) are well-characterized genetic markers of risk of thiopurine-induced adverse events, and TPMT genotyping prior to initiation of thiopurine treatment is recommended by the U.S. Food and Drug Administration. However, it is believed that other factors affecting the risk of such adverse events are present in the Japanese population, since TPMT risk allele frequencies in this country are lower than those in Western countries, and the incidence of adverse reactions to thiopurines is high in Japan, even among carriers of wild-type TPMT.345
In 2014, Yang et al.6 reported that a missense variant in exon 3 of the NUDT15 gene (p.Arg139Cys or R139C; single nucleotide polymorphism [SNP] ID: rs116855232) strongly correlates with thiopurine-induced leukopenia among Korean patients with CD. The high specificity and sensitivity (89.4% and 93.2%, respectively) of NUDT15 p.Arg139Cys recorded by these authors indicate that this variant, rather than TPMT polymorphisms, may be an effective genetic marker for predicting thiopurine-induced adverse events, at least in East Asian populations. To date, this strong association has been confirmed in numerous studies involving subjects with IBD or ALL.789101112131415161718 In addition, a further investigation identified 4 NUDT15 coding variants, including p.Arg139Cys, that influence both nucleotide diphosphatase activity and levels of thiopurine active metabolites, and found loss-of-function NUDT15 variants to be associated with thiopurine intolerance.13 Moreover, a more recent genome-wide association study conducted by Kim et al.19 found an FTO coding variant and a proximal region of RUNX1 to be associated with thiopurine-induced leukopenia among East Asian patients with IBD.
These findings suggest that the p.Arg139Cys coding variant of NUDT15 may be a highly reliable marker of thiopurine cytotoxicity risk, especially in Asian populations. However, in patients lacking a risk-associated TPMT variant and NUDT15 p.Arg139Cys, thiopurine cytotoxicity may be explained by the other abovementioned NUDT15 coding sequence variations or FTO or RUNX1 variants. Therefore, it is important to examine correlations between genes recently identified using genome-wide analysis and adverse clinical events.
Thus, in the present study, we investigated the associations between 3 coding variants in NUDT15 and thiopurine-induced adverse events among Japanese subjects. Furthermore, we examined potential relationships between single sequence variations in FTO and RUNX1 with such events in a Japanese population.
1. Patients
One hundred sixty Japanese patients with CD, UC, IBD unclassified, or intestinal Behçet disease having visited the Hyogo College of Medicine Hospital were included in this study. All patients, the characteristics of whom are shown in Table 1, were treated with AZA or 6-MP. This study was approved by the Ethical Review Board of Hyogo College of Medicine (approval number: Rin-hi-322), and written informed consent was obtained from all patients before their inclusion in this study.
2. Thiopurine Therapy for IBD and Adverse Events
Initial AZA and 6-MP doses of 25 to 50 and 10 to 20 mg/day, respectively, were administered. Generally, signs of adverse events were checked 2 to 3 weeks after treatment initiation, and when none were detected, AZA and 6-MP doses were raised to 50 to 100 and 30 to 50 mg/day, respectively. Nausea is an adverse event commonly associated with thiopurine therapy. Mild nausea symptoms are usually transient, but severe nausea can lead to discontinuation of thiopurine treatment.20 In this study, the group defined as having gastrointestinal (GI) intolerance to AZA included only those patients who discontinued AZA therapy because of GI symptoms such as severe nausea and epigastralgia. However, AZA-intolerant patients with associated GI symptoms who were successfully switched to 6-MP were not included in the GI intolerance group. We defined leukopenia as a WBC count <3,000/µL, and severe hair loss as objective hair loss that might necessitate the wearing of a wig and requiring a few months for recovery.7 Early or late leukopenia was defined as in previous studies (early leukopenia, within 8 weeks; late leukopenia, after 8 weeks).67
3. DNA Extraction
Genomic DNA was extracted from peripheral blood using a Blood & Cell Culture DNA Midi Kit (Qiagen, Hilden, Germany) or a BioRobot EZ1 (Qiagen) at our college. Of the 160 blood samples, 39 collected between June and November 2016 were sent to the LSI Medience Corporation (Tokyo, Japan) for DNA extraction and analysis.
4. SNP Genotyping
Genotyping of NUDT15 p.Arg139Cys (rs116855232), FTO p.Ala134Thr (rs79206939), and a proximal region of RUNX1 (rs2834826) was performed using TaqMan SNP Genotyping Assays (assay IDs: C_154823200_10, C_102162425_10, and C_3266345_10, respectively) with TaqMan Genotyping Master Mix (Thermo Fisher Scientific, Waltham, MA, USA). Real-time PCR and allelic discrimination analysis were carried out using an ABI 7500 system (Applied Biosystems, Foster City, CA, USA). As PCR using probes for NUDT15 p.Arg139Cys is not effective for samples from individuals carrying NUDT15 p.Arg139His (rs147390019), genotyping of the latter was attempted by Sanger sequencing when the TaqMan SNP Assay for the former failed. The primer sequences used for Sanger sequencing of NUDT15 exon 3 were as follows: forward, AAGCAAATGCAAAGCATCAC; and reverse, GGCTGAAAGAGTGGGGGATA.13 The primers used to detect both NUDT15 p.Val18_Val19insGlyVal (rs554405994) and p.Val18Ile (rs186364861) in exon 1 using Sanger sequencing were as follows: forward, CAAAGCACAACTGTAAGCGACT; and reverse, GAAAGACCCAGCTAGCAAAGAC.13 The PCR products were purified using an ExoSAP-IT PCR Product Cleanup Kit (Affymetrix, Santa Clara, CA, USA), and sequencing was performed using a BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems). The sequencing products were purified with a BigDye XTerminator™ Purification Kit and analyzed on a 3130xl or 3500xl genetic analyzer (Applied Biosystems).
5. Statistical Analysis
Categorical variables were compared using the chi-square test, or Fisher test when the expected value of any cell was less than 5. A Mann-Whitney or Kruskal-Wallis test was used to compare the difference in thiopurine dose or interval between each genotype. Statistical analysis was conducted using GraphPad Prism version 6.07 (GraphPad Software, La Jolla, CA, USA) and P-values <0.05 were considered statistically significant.
1. Patient Baseline Characteristics and Genotype Frequencies for Each Variant
We recruited 160 patients with CD, UC, IBD unclassified, or intestinal Behçet disease in this study, the characteristics of whom are summarized in Table 1. The mean age of patients with leukopenia was significantly higher than that of those without leukopenia (P=0.0069). Although 6-MP-treated patients were more predisposed to leukopenia than AZA-treated patients, this is likely because physicians preferentially administer 6-MP, which exists as a powdered formulation suitable for small dose reductions, to thiopurine-treated patients whose WBC count declines. No significant differences were observed with respect to sex, body weight, disease type, use of co-medications such as 5-aminosalicylic acid, prednisolone, and anti-tumor necrosis factor α agents, initial thiopurine dose, or follow-up period.
Genotype frequencies of the 6 variants analyzed are shown in Table 2. Of the 160 subjects, 11 (6.9%), 2 (1.2%), and 9 (5.6%) were heterozygous for NUDT15 p.Val18_Val19insGly-Val, NUDT15 p.Val18Ile, and FTO p.Ala134Thr, respectively. None were homozygous for these variants. Wild-type, heterozygous, and homozygous variant NUDT15 p.Arg139Cys genotypes were carried by 117 (73.1%), 35 (21.9%), and 8 (5.0%) patients, respectively. For the rs2834826 noncoding sequence variation in RUNX1, 60 wild-type (37.5%), 80 heterozygous (50.0%), and 20 homozygous variant (12.5%) individuals were identified. The NUDT15 p.Arg139His variant was not detected in our study sample.
2. Three NUDT15 Coding Variants and GI Intolerance to AZA
Of the 160 patients, 10 AZA- and 1 6-MP-treated patient experienced intolerable epigastralgia or nausea after initiation of therapy, and treatment was therefore discontinued. First, we investigated the correlation between GI intolerance to AZA and the coding variants of NUDT15. Nitroimidazole, which derives from AZA and causes nausea, is absent from 6-MP.21 Treatment with 6-MP may thus help to prevent or diminish nausea.22 Therefore, only AZA-treated patients were included in this analysis (Table 3).
The 4 nucleotide sequence variations leading to changes in the amino acid sequence of the NUDT15 protein are located in exon 1 (rs554405994 [p.Val18_Val19insGlyVal] and rs186364861 [p.Val18Ile]) and exon 3 (rs116855232 [p.Arg139Cys] and rs147390019 [p.Arg139His]).13 The 3 NUDT15 coding variants identified in our study group (p.Val18_Val19insGlyVal, p.Val18Ile, and p.Arg139Cys) were not significantly associated with GI intolerance to AZA (Table 3). However, comparing NUDT15 p.Arg139Cys genotypes with respect to the interval between initiation and discontinuation of AZA therapy revealed that patients carrying the C/T or T/T genotype discontinued AZA significantly earlier than those with the wild-type C/C genotype (Fig. 1). These data suggest that although GI intolerance to AZA occurred regardless of NUDT15 genotype, p.Arg139Cys risk allele carriers discontinued AZA earlier than wild-type carriers owing to differing symptom severity.
3. Correlation between NUDT15 Variants and Leukopenia and Severe Hair Loss
The NUDT15 p.Arg139Cys variant is in current use as a reliable marker of risk of thiopurine-induced leukopenia and severe hair loss. However, it remains unclear whether other coding variants also cause these adverse events in patients with IBD. Therefore, we next analyzed the correlation between 3 NUDT15 coding variants and these events. The 11 subjects who, due to GI intolerance, discontinued AZA (Table 3) or 6-MP therapy 1 to 9 weeks after its initiation were excluded from this analysis, since this time period was insufficient to evaluate leukopenia or severe hair loss. One hundred forty-nine subjects were therefore assessed, and the results are presented in Table 4. The frequencies of p.Val18_Val19insGlyVal, p.Val18Ile, and p.Arg139Cys alleles were similar to those shown in Table 3. The coding variants in exon 1 of NUDT15 (p.Val18_Val19insGlyVal and p.Val18Ile) were not associated with leukopenia or severe hair loss. In contrast, strong associations with that in exon 3 (p.Arg139Cys) were evident. The P-value for the relationship between p.Val18_Val19insGlyVal genotype and leukopenia (no leukopenia versus combined early and late leukopenia) was 0.0512. However, this variant is in high linkage disequilibrium with p.Arg139Cys;13 therefore, the effect of p.Val18_Val19insGlyVal alone may not be strong.
We identified 2 subjects heterozygous for the p.Val18Ile variant, both of whom exhibited late leukopenia. However, this relationship was not statistically significant (P=0.1029) owing to the relatively small sample size. These 2 patients developed leukopenia approximately 3 years after initiation of AZA treatment, and quickly recovered after interruption of this therapy, without granulocyte-colony stimulating factor administration.
4. Analysis of NUDT15 p.Arg139Cys Genotype and Interval to Leukopenia and Thiopurine Dose
Further analysis of p.Arg139Cys genotypes was performed, the results of which are shown in Fig. 2. The mean interval from initiation of thiopurine therapy to leukopenia among subjects carrying the C/C, C/T, and T/T genotype was 19.81, 13.67, and 1.01 months, respectively (P=0.0009) (Fig. 2A). None of the patients with the T/T genotype were able to continue thiopurine therapy for more than 9 weeks due to GI intolerance, leukopenia, or severe hair loss. To compare the average thiopurine dose administered between each genotype, we considered only subjects having continued thiopurine therapy for more than 1 year. Carriers of the C/T genotype tended to require frequent reductions in thiopurine dose during the first year of therapy due to leukopenia. As a result, average thiopurine doses given to patients with the C/T genotype were significantly lower than those administered to C/C genotype carriers (0.77 and 1.01 mg/kg/day, respectively; P=0.0296) (Fig. 2B).
5. FTO p.Ala134Thr and the rs2834826 Noncoding Variant in the Proximal Region of RUNX1 Are Not Associated with Leukopenia or Severe Hair Loss among Japanese Patients with IBD
Many FTO and RUNX1 loci have been associated with thiopurine-induced leukopenia in the East Asian population.19 In particular, a non-synonymous coding sequence variation in FTO (p.Ala134Thr, rs79206939) has been shown to reduce FTO activity. Consistent with these results, FTO−/− and FTO+/− mice exhibit increased sensitivity to thiopurine.19 Therefore, we investigated the association of the FTO p.Ala134Thr variation and a noncoding variant in the proximal region of RUNX1 (rs2834826) with thiopurine-induced leukopenia and severe hair loss among Japanese patients with IBD.
Nine subjects were heterozygous for the A risk allele of FTO p.Ala134Thr. Of these, 4 developed leukopenia, but this association was not statistically significant (P=0.7404). Moreover, none of the 9 patients exhibited severe hair loss. RUNX1 rs2834826 was not associated with leukopenia or severe hair loss (P=0.4869 and P=0.5023, respectively) (Table 5).
AZA and 6-MP have been widely used as immunomodulators and chemotherapeutic agents for the treatment of various diseases. At our hospital, more than 100 patients with IBD commence thiopurine therapy each year, and this number is increasing due to the growing incidence of IBD in Japan. Every year, several patients present with early leukopenia or severe hair loss after initiating thiopurine treatment. To date, for such patients carrying the wild-type TPMT genotype, the cause of these adverse events could not be determined.
Discovery of the association between NUDT15 p.Arg139Cys and thiopurine-induced leukopenia among Korean CD patients may enable unprecedented progress in the management of adverse thiopurine effects in the East Asian population.6 Importantly, many investigators have been able to replicate these results in studies of thiopurine-treated patients with IBD or ALL.789101112131415161718 In the current study, we successfully established a significant association between NUDT15 p.Arg139Cys and thiopurine-induced leukopenia and severe hair loss.
We obtained evidence that this variant correlates with the time interval between AZA initiation and GI intolerance to this drug (Fig. 1). The abnormal accumulation of thiopurine metabolites in patients carrying p.Arg139Cys may accelerate development of strong nausea. However, our results in this respect may be limited by certain arbitrary aspects of the analysis, given the subjectivity of nausea and that the decision to discontinue thiopurine therapy is dependent on physicians and patients.
As evidence of the role of NUDT15 in thiopurine treatment accumulates, the demand for NUDT15 genotyping prior to such therapy is increasing in Japan. Although these replicable results should be translated into clinical practice, further evaluation of NUDT15 variants is necessary before clinical application. Consequently, we investigated three coding sequence variations in NUDT15 identified by Moriyama et al.13 No association between the p.Val18_Val19insGlyVal and p.Val18Ile variants and leukopenia or severe hair loss was evident in our study. However, it should be noted that these adverse events did occur more frequently among subjects heterozygous for these coding variants (Table 4); therefore, it is likely that they are significantly more common among homozygous risk allele carriers, as observed in relation to the p.Arg139Cys mutation. The strong linkage disequilibrium between p.Val18_Val19insGlyVal and p.Arg139Cys should be taken into account however.13 These coding variants result in 74.4% to 100% loss of NUDT15 enzymatic activity.13 Therefore, carriers of the exon 1 variation may need to be followed-up carefully to monitor for signs of leukopenia. Future studies are expected to shed light on the importance of p.Val18_Val19insGlyVal and p.Val18Ile as predictive markers of thiopurine-induced adverse events.
In our study sample, 8 subjects homozygous for the T allele of NUDT15 p.Arg139Cys were identified. One of these individuals discontinued AZA therapy within 7 days following its initiation due to intolerable GI symptoms (Table 3, Fig. 1). Six of the 8 subjects were able to continue AZA treatment for more than 2 weeks, but discontinued it because of early or late leukopenia, the latter being detected at 9 weeks (Table 4). All of the homozygous T/T subjects with leukopenia exhibited grade 4 leukopenia (defined as a WBC <1,000 cells/µL) and required both granulocyte-colony stimulating factor and antibiotics. Only 1 patient carrying this genotype did not develop leukopenia. However, all 7 patients who continued thiopurine therapy for more than 2 weeks experienced severe hair loss. Therefore, administration of thiopurines to patients with the NUDT15 p.Arg139Cys T/T genotype caused drastic adverse events. We currently do not use thiopurine therapy for patients with IBD and this genotype because it is contraindicated. It remains unclear whether an extremely low dose of 6-MP would be tolerable or clinically efficacious for Japanese carriers of this genotype suffering IBD.
The physiological function of NUDT15 is considered to be the hydrolysis of 8-oxo-dGTP generated from reactive oxygen species.23 Recent studies indicate that NUDT15 preferentially inactivates thiopurine metabolites over 8-oxo-dGTP,24 converting those such as TGTP and TdGTP to TGMP and TdGMP, respectively.13 NUDT15 is a negative regulator that decreases levels of bioactive thiopurine metabolites, the cytotoxicity of which is therefore increased by loss-of-function variants. Our data obtained from analyzing adverse events among thiopurine-treated patients indicate that the NUDT15 Arg139Cys site may be more critical to thiopurine metabolism than those loci affected by the other coding variants examined. The precise molecular mechanisms by which the p.Arg139Cys mutation leads to thiopurine-induced cell death remain unclear.
The site of the Arg139Cys mutation is reported to be within the TGTP-binding pocket of the NUDT15 protein. Substitution of arginine with cysteine at this position may affect the enzyme's structure, and thereby, reduce cellular TGTP hydrolysis.24 One study has shown that NUDT15 proteins harboring the Arg139Cys mutation demonstrate enzyme activity comparable to that of the wild-type form, but are degraded rapidly in cells.25 Therefore, NUDT15 protein level may be implicated in the cytotoxicity of and sensitivity to thiopurines. The development of biochemical tests of NUDT15 enzymatic activity would be beneficial.
Sequence variations in the genes FTO and RUNX1 identified using a genome-wide association study are also promising candidates as predictive markers of thiopurine cytotoxicity.19 However, we could not verify the association between thiopurine-induced adverse events and FTO p.Ala134Thr and a noncoding variant in the proximal region of RUNX1 among Japanese patients with IBD. This may be due to differences between Korean and Japanese patients with this condition in terms of the thiopurine doses administered. We usually initiate AZA and 6-MP treatment at relatively low doses (25 and 10–20 mg/day, respectively), and sometimes gradually increase the dose while paying attention to the development of adverse events such as GI symptoms and leukopenia. For Japanese patients with IBD, even low doses of thiopurines are clinically effective and result in therapeutic concentrations of the thiopurine metabolite 6-thioguanine nucleotide;2627 therefore, the AZA maintenance dose of 25 to 100 mg/day (equivalent to 0.5–2.0 mg/kg/day for a patient weighing 50 kg) is commonly used, as shown in Fig. 2B. We did not identify any homozygous FTO p.Ala134Thr risk allele carriers in this study, who are expected to exhibit more prominent effects of thiopurine exposure. As our sample size was not large enough, further analysis will be required to elucidate the association between these genes and thiopurine-induced adverse events in the Japanese population.
In summary, we verified the strong association between NUDT15 p.Arg139Cys and thiopurine-induced early and late leukopenia and severe hair loss among Japanese patients with IBD. However, NUDT15 p.Val18_Val19insGlyVal, NUDT15 p.Val18Ile, FTO p.Ala134Thr, and a noncoding variant in the proximal region of RUNX1 (rs2834826) were not associated with these adverse events. Thus, NUDT15 p.Arg139Cys genotyping should currently be prioritized for the prediction of thiopurine-induced adverse events among Japanese patients with IBD, and its application in precision medicine should be considered in the future.

Financial support: This study was supported by the Japan Society for the Promotion of Science (JSPS) KAKENHI (grant number: 15K08976) and the Program for Promoting Practical Applications of Genomic Medicine of the Japan Agency for Medical Research and Development (AMED).

Conflict of interest: None.

  • 1. Yamada S, Yoshino T, Matsuura M, et al. Efficacy and safety of long-term thiopurine maintenance treatment in Japanese patients with ulcerative colitis. Intest Res 2015;13:250–258.PMID: 26131000.ArticlePubMedPMC
  • 2. Yoshino T, Matsuura M, Minami N, et al. Efficacy of thiopurines in biologic-naïve Japanese patients with Crohn's disease: a single-center experience. Intest Res 2015;13:266–273.PMID: 26131002.ArticlePubMedPMC
  • 3. Roberts RL, Barclay ML. Update on thiopurine pharmacogenetics in inflammatory bowel disease. Pharmacogenomics 2015;16:891–903.PMID: 26067482.ArticlePubMed
  • 4. Takatsu N, Matsui T, Murakami Y, et al. Adverse reactions to azathioprine cannot be predicted by thiopurine S-methyltransferase genotype in Japanese patients with inflammatory bowel disease. J Gastroenterol Hepatol 2009;24:1258–1264.PMID: 19682195.ArticlePubMed
  • 5. Lee KM, Kim YS, Seo GS, Kim TO, Yang SK. IBD Study Group of the Korean Association for the Study of Intestinal Diseases. Use of thiopurines in inflammatory bowel disease: a consensus statement by the Korean Association for the Study of Intestinal Diseases (KASID). Intest Res 2015;13:193–207.PMID: 26130993.ArticlePubMedPMC
  • 6. Yang SK, Hong M, Baek J, et al. A common missense variant in NUDT15 confers susceptibility to thiopurine-induced leukopenia. Nat Genet 2014;46:1017–1020.PMID: 25108385.ArticlePubMedPMCPDF
  • 7. Kakuta Y, Naito T, Onodera M, et al. NUDT15 R139C causes thiopurine-induced early severe hair loss and leukopenia in Japanese patients with IBD. Pharmacogenomics J 2016;16:280–285.PMID: 26076924.ArticlePubMedPDF
  • 8. Asada A, Nishida A, Shioya M, et al. NUDT15 R139C-related thiopurine leukocytopenia is mediated by 6-thioguanine nucleotide-independent mechanism in Japanese patients with inflammatory bowel disease. J Gastroenterol 2016;51:22–29.PMID: 26590936.ArticlePubMedPDF
  • 9. Yang JJ, Landier W, Yang W, et al. Inherited NUDT15 variant is a genetic determinant of mercaptopurine intolerance in children with acute lymphoblastic leukemia. J Clin Oncol 2015;33:1235–1242.PMID: 25624441.ArticlePubMedPMC
  • 10. Tanaka Y, Kato M, Hasegawa D, et al. Susceptibility to 6-MP toxicity conferred by a NUDT15 variant in Japanese children with acute lymphoblastic leukaemia. Br J Haematol 2015;171:109–115.PMID: 26033531.ArticlePubMed
  • 11. Lee YJ, Hwang EH, Park JH, Shin JH, Kang B, Kim SY. NUDT15 variant is the most common variant associated with thiopurine-induced early leukopenia and alopecia in Korean pediatric patients with Crohn's disease. Eur J Gastroenterol Hepatol 2016;28:475–478.PMID: 26735160.ArticlePubMed
  • 12. Liang DC, Yang CP, Liu HC, et al. NUDT15 gene polymorphism related to mercaptopurine intolerance in Taiwan Chinese children with acute lymphoblastic leukemia. Pharmacogenomics J 2016;16:536–539.PMID: 26503813.ArticlePubMedPDF
  • 13. Moriyama T, Nishii R, Perez-Andreu V, et al. NUDT15 polymorphisms alter thiopurine metabolism and hematopoietic toxicity. Nat Genet 2016;48:367–373.PMID: 26878724.ArticlePubMedPMCPDF
  • 14. Shah SA, Paradkar M, Desai D, Ashavaid TF. Nucleoside diphosphate-linked moiety X-type motif 15 C415T variant as a predictor for thiopurine-induced toxicity in Indian patients. J Gastroenterol Hepatol 2017;32:620–624.PMID: 27416873.ArticlePubMed
  • 15. Suzuki H, Fukushima H, Suzuki R, et al. Genotyping NUDT15 can predict the dose reduction of 6-MP for children with acute lymphoblastic leukemia especially at a preschool age. J Hum Genet 2016;61:797–801.PMID: 27193222.ArticlePubMedPDF
  • 16. Zhu X, Wang XD, Chao K, et al. NUDT15 polymorphisms are better than thiopurine S-methyltransferase as predictor of risk for thiopurine-induced leukopenia in Chinese patients with Crohn's disease. Aliment Pharmacol Ther 2016;44:967–975.PMID: 27604507.ArticlePubMed
  • 17. Zgheib NK, Akika R, Mahfouz R, et al. NUDT15 and TPMT genetic polymorphisms are related to 6-mercaptopurine intolerance in children treated for acute lymphoblastic leukemia at the Children's Cancer Center of Lebanon. Pediatr Blood Cancer 2017;64:146–150.PMID: 27577869.ArticlePubMed
  • 18. Chiengthong K, Ittiwut C, Muensri S, et al. NUDT15 c.415C>T increases risk of 6-mercaptopurine induced myelosuppression during maintenance therapy in children with acute lymphoblastic leukemia. Haematologica 2016;101:e24–e26.PMID: 10.3324/haematol.2015.134775.PMID: 26405151.ArticlePubMedPMC
  • 19. Kim HS, Cheon JH, Jung ES, et al. A coding variant in FTO confers susceptibility to thiopurine-induced leukopenia in East Asian patients with IBD [published online ahead of print August 24, 2016]. Gut 2016;PMID: 10.1136/gutjnl-2016-311921..
  • 20. Tanis AA. Azathioprine in inflammatory bowel disease, a safe alternative? Mediators Inflamm 1998;7:141–144.PMID: 9705598.ArticlePubMedPMCPDF
  • 21. Roberts RL, Barclay ML. Current relevance of pharmacogenetics in immunomodulation treatment for Crohn's disease. J Gastroenterol Hepatol 2012;27:1546–1554.PMID: 22741564.ArticlePubMed
  • 22. Lees CW, Maan AK, Hansoti B, Satsangi J, Arnott ID. Tolerability and safety of mercaptopurine in azathioprine-intolerant patients with inflammatory bowel disease. Aliment Pharmacol Ther 2008;27:220–227.PMID: 17988235.ArticlePubMed
  • 23. Takagi Y, Setoyama D, Ito R, Kamiya H, Yamagata Y, Sekiguchi M. Human MTH3 (NUDT18) protein hydrolyzes oxidized forms of guanosine and deoxyguanosine diphosphates: comparison with MTH1 and MTH2. J Biol Chem 2012;287:21541–21549.PMID: 22556419.ArticlePubMedPMC
  • 24. Carter M, Jemth AS, Hagenkort A, et al. Crystal structure, biochemical and cellular activities demonstrate separate functions of MTH1 and MTH2. Nat Commun 2015;6:7871PMID: 26238318.ArticlePubMedPMCPDF
  • 25. Valerie NC, Hagenkort A, Page BD, et al. NUDT15 hydrolyzes 6-thio-deoxyGTP to mediate the anticancer efficacy of 6-thioguanine. Cancer Res 2016;76:5501–5511.PMID: 27530327.ArticlePubMedPMC
  • 26. Andoh A, Tsujikawa T, Ban H, et al. Monitoring 6-thioguanine nucleotide concentrations in Japanese patients with inflammatory bowel disease. J Gastroenterol Hepatol 2008;23:1373–1377.PMID: 18662197.ArticlePubMed
  • 27. Komiyama T, Yajima T, Kubota R, et al. Lower doses of 6-mercaptopurine/azathioprine bring enough clinical efficacy and therapeutic concentration of erythrocyte 6-mercaptopurine metabolite in Japanese IBD patients. J Crohns Colitis 2008;2:315–321.PMID: 21172230.ArticlePubMedPDF
Fig. 1

Interval from initiation to discontinuation of azathioprine among patients with gastrointestinal intolerance.

ir-15-328-g001.jpg
Fig. 2

(A) Interval from initiation of thiopurine treatment to leukopenia development according to NUDT15 p.Arg139Cys genotype. (B) Association between NUDT15 p.Arg139Cys genotype and thiopurine dose tolerated.

ir-15-328-g002.jpg
Table 1

Baseline Characteristics of Patients

ir-15-328-i001.jpg
Variable Total No leukopenia Leukopenia P-valuea
Sex (male/female) 96/64 60/41 (59.4/40.6) 36/23 (61.0/39.0) 0.8686
Age (yr) 40.3 (18–74) 38.3 (18–74) 43.6 (20–74) 0.0069
Body weight (kg) 54.6 (37–90) 53.7 (31–80) 54.4 (38–77) 0.6358
Diagnosis 0.2706
 CD 86 57 (66.3) 29 (33.7)
 UC 72 44 (61.1) 28 (38.9)
 IBDu 1 0 1 (100.0)
 Intestinal Behçet 1 0 1 (100.0)
5-ASA 0151 98 (64.9) 53 (35.1) 0.0767
Prednisolone 94 59 (62.8) 35 (37.2) 0.9106
Anti-TNF-α agent (infliximab or adalimumab) 89 62 (69.7) 27 (30.3) 0.0697
AZA/6-MP 123/37 84/17 (83.2/16.8) 39/20 (66.1/33.9) 0.0135
Initial AZA dose (mg/kg/day) 0.759±0.247 0.757±0.229 0.764±0.287 0.5760
Initial 6-MP dose (mg/kg/day) 0.316±0.167 0.282±0.098 0.331±0.196 0.9680
Follow-up period of thiopurine therapy (mo) 43.6 (0.25–132.00) 42.1 (0.25–132.00) 46.0 (0.50–126.00) 0.9965

Values are presented as number (%), mean (range), or mean±SD.

aNo leukopenia vs. leukopenia.

IBDu, IBD unclassified; 5-ASA, 5-aminosalicylic acid; TNF-α, tumor necrosis factor α; AZA, azathioprine; 6-MP, 6-mercaptopurine.

Table 2

Genotype Frequencies in Variants of NUDT15, FTO, and RUNX1

ir-15-328-i002.jpg
Genotype Total (n=160) CD (n=86) UC (n=72) IBDu (n=1) Intestinal Behçet (n=1)
NUDT15 p.Val18_Val19insGlyVal
 -/- 149 (93.1) 80 (53.7) 67 (45.0) 1 (0.7) 1 (0.7)
 -/GGAGTC 11 (6.9) 6 (54.5) 5 (45.5) 0 0
NUDT15 p.Val18Ile
 G/G 158 (98.8) 85 (53.8) 71 (44.9) 1 (0.6) 1 (0.6)
 G/A 2 (1.2) 1 (50.0) 1 (50.0) 0 0
NUDT15 p.Arg139Cys
 C/C 117 (73.1) 68 (58.1) 49 (41.9) 0 0
 C/T 35 (21.9) 15 (42.9) 18 (51.4) 1 (2.9) 1 (2.9)
 T/T 8 (5.0) 3 (37.5) 5 (62.5) 0 0
NUDT15 p.Arg139His
 G/G 160 (100.0) 86 (53.8) 72 (45.0) 1 (0.6) 1 (0.6)
 G/A 0 0 0 0 0
FTO p.Ala134Thr
 G/G 151 (94.3) 82 (54.3) 68 (45.0) 1 (0.7) 0
 G/A 9 (5.6) 4 (44.4) 4 (44.4) 0 1 (11.1)
RUNX1intergenic (rs2834826)
 C/C 60 (37.5) 31 (51.7) 29 (48.3) 0 0
 C/T 80 (50.0) 45 (56.3) 33 (41.3) 1 (1.3) 1 (1.3)
 T/T 20 (12.5) 10 (50.0) 10 (50.0) 0 0

Values are presented as number (%).

IBDu, IBD unclassified.

Table 3

No Correlation between NUDT15 Genotypes and the Incidence of GI Intolerance to Azathioprine

ir-15-328-i003.jpg
Gene NUDT15
Coding SNP (location) p.Val18_Val19insGlyVal (exon 1) p.Val18Ile (exon 1) p.Arg139Cys (exon 3)
Type of variants 6-bp insertion P-value Missense P-value Missense P-value
Genotype -/- -/GGAGTC G/G G/A C/C C/T T/T
No. of patients 116 (94.3) 7 (5.7) 121 (98.4) 2 (1.6) 93 (75.6) 22 (17.9) 8 (6.5)
Male/female 66/50 6/1 71/50 1/1 54/39 13/9 5/3
No GI intolerance 107 (94.7) 6 (5.3) 111 (98.2) 2 (1.8) 86 (76.1) 20 (17.7) 7 (6.2)
GI intolerance 9 (90.0) 1 (10.0) 0.4562 10 (100.0) 0 - 7 (70.0) 2 (20.0) 1 (10.0) 0.8706

Values are presented as number (%).

GI, gastrointestinal; SNP, single nucleotide polymorphism.

Table 4

Associations between NUDT15 Genotype and Leukopenia and Severe Hair Loss

ir-15-328-i004.jpg
Gene NUDT15
Coding SNP (location) p.Val18_Val19insGlyVal (exon 1) p.Val18Ile (exon 1) p.Arg139Cys (exon 3)
Type of variants 6-bp insertion P-value Missense P-value Missense P-value
Genotype -/- -/GGAGTC G/G G/A C/C C/T T/T
No. of patients 139 (93.3) 10 (6.7) 147 (98.7) 2 (1.3) 109 (73.2) 33 (22.1) 7 (4.7)
Male/female 82/57 8/2 89/58 1/1 65/44 21/12 4/3
No leukopenia 87 (96.7) 3 (3.3) 90 (100.0) 0 80 (88.8) 9 (10.0) 1 (1.1)
Leukopenia 52 (88.1) 7 (11.9) 0.0512 57 (96.6) 2 (3.4) 0.1552 29 (49.1) 24 (40.7) 6 (10.2) <0.0001
 Early leukopenia 14 (87.5) 2 (12.5) 0.1629 16 (100.0) 0 - 3 (18.7) 8 (50.0) 5 (31.3) <0.0001
 Late leukopenia 38 (88.4) 5 (11.6) 0.1113 41 (95.3) 2 (4.7) 0.1029 26 (60.5) 16 (37.2) 1 (2.3) 0.0006
No severe hair loss 132 (93.0) 10 (7.0) 140 (98.6) 2 (1.4) 109 (76.8) 33 (23.2) 0
Severe hair loss 7 (100.0) 0 - 7 (100.0) 0 - 0 0 7 (100.0) <0.0001

Values are presented as number (%).

SNP, single nucleotide polymorphism.

Table 5

No association of FTO and RUNX1 with Leukopenia and Severe Hair Loss in a Japanese Population

ir-15-328-i005.jpg
Gene FTO RUNX1
SNP (location) p.Ala134Thr (exon 3) RUNX1 intergenic (rs2834826)
Type of variants Missense P-value Non coding variant P-value
Genotype G/G A/G C/C C/T T/T
No. of patients 140 (94.0) 9 (6.0) 56 (37.6) 73 (49.0) 20 (13.4)
Male/female 84/56 6/3 35/21 46/27 9/11
No leukopenia 85 (94.4) 5 (5.6) 33 (36.7) 47 (52.2) 10 (11.1)
Leukopenia 55 (93.2) 4 (6.8) 0.7404 23 (39.0) 26 (44.1) 10 (16.9) 0.4869
 Early leukopenia 15 (93.7) 1 (6.3) - 5 (31.2) 8 (50.0) 3 (18.8) 0.6803
 Late leukopenia 40 (93.0) 3 (7.0) 0.7130 18 (41.9) 18 (41.9) 7 (16.3) 0.4839
No severe hair loss 133 (93.7) 9 (6.3) 52 (36.6) 71 (50.0) 19 (13.4)
Severe hair loss 7 (100.0) 0 4 (57.1) 2 (28.6) 1 (14.3) 0.5023

Values are presented as number (%).

SNP, single nucleotide polymorphism.

Figure & Data

REFERENCES

    Citations

    Citations to this article as recorded by  
    • A case of rapidly progressive hair loss due to azathioprine, and the prevalence of NUDT15 variants among Japanese patients with autoimmune blistering diseases: A single‐center retrospective observational study
      Sho Katayama, Kentaro Izumi, Inkin Ujiie, Hideyuki Ujiie
      The Journal of Dermatology.2025; 52(2): 363.     CrossRef
    • Comparative study on the pathogenesis of Crohn’s disease and ulcerative colitis
      Qi-Hang Yang, Chuang-Nian Zhang
      World Journal of Gastroenterology.2025;[Epub]     CrossRef
    • Real-world NUDT15 genotyping and thiopurine treatment optimization in inflammatory bowel disease: a multicenter study
      Motoki Makuuchi, Yoichi Kakuta, Junji Umeno, Toshimitsu Fujii, Tetsuya Takagawa, Takashi Ibuka, Miki Miura, Yu Sasaki, Sakuma Takahashi, Hiroshi Nakase, Hiroki Kiyohara, Keiichi Tominaga, Yosuke Shimodaira, Sakiko Hiraoka, Nobuhiro Ueno, Shunichi Yanai, T
      Journal of Gastroenterology.2024; 59(6): 468.     CrossRef
    • Differences in the risk of clinical failure between thiopurine and methotrexate in bio-naïve patients with Crohn’s disease: a Korean nationwide population-based study
      Yu Kyung Jun, Eunjeong Ji, Hye Ran Yang, Yonghoon Choi, Cheol Min Shin, Young Soo Park, Nayoung Kim, Dong Ho Lee, Hyuk Yoon
      Therapeutic Advances in Gastroenterology.2024;[Epub]     CrossRef
    • A systematic review of aspects of NUDT15 pharmacogenomic variants and thiopurine-induced myelosuppression
      Rachel Palmer, Jaime Peters
      RPS Pharmacy and Pharmacology Reports.2024;[Epub]     CrossRef
    • m6A modification in inflammatory bowel disease provides new insights into clinical applications
      Jiamin Zhang, Bimei Song, Yue Zeng, Chao Xu, Liang Gao, Yan Guo, Jingbo Liu
      Biomedicine & Pharmacotherapy.2023; 159: 114298.     CrossRef
    • Targeting FTO by Dac51 contributes to attenuating DSS-induced colitis
      Chunyan Peng, Chang Zheng, Fan Zhou, Ying Xie, Lei Wang, Deyan Chen, Xiaoqi Zhang
      International Immunopharmacology.2023; 116: 109789.     CrossRef
    • Single-Nucleotide Polymorphisms, c.415C > T (Arg139Cys) and c.416G > A (Arg139His), in the NUDT15 Gene Are Associated with Thiopurine-Induced Leukopenia
      Tetsuichiro Isono, Daiki Hira, Yoshito Ikeda, Masahiro Kawahara, Satoshi Noda, Atsushi Nishida, Osamu Inatomi, Noriki Fujimoto, Akira Andoh, Tomohiro Terada, Shin-ya Morita
      Biological and Pharmaceutical Bulletin.2023; 46(3): 412.     CrossRef
    • Evaluation of FTO polymorphism in 6-mercaptopurine related intolerance in children with acute lymphoblastic leukemia
      Minu Singh, Divya Bhaskar, Prateek Bhatia, Rozy Thakur, Pankaj Sharma, Deepak Bansal, Richa Jain, Amita Trehan
      Cancer Chemotherapy and Pharmacology.2023; 92(1): 51.     CrossRef
    • Time to incorporate preemptive NUDT15 testing before starting thiopurines in inflammatory bowel disease in Asia and beyond: a review
      Devendra Desai, Anuraag Jena, Vishal Sharma, Toshifumi Hibi
      Expert Review of Clinical Pharmacology.2023; 16(7): 643.     CrossRef
    • Safety and efficacy of personalized versus standard initial dosing of thiopurines: Systematic review and meta-analysis of randomized trials
      Anuraag Jena, Chhagan L Birda, Arup Choudhury, Vishal Sharma
      Expert Opinion on Drug Safety.2023; 22(12): 1253.     CrossRef
    • Comparative assessment of anti-cancer drugs against NUDT15 variants to prevent leucopenia side effect in leukemia patients
      V. Janakiraman, M. Sudhan, Khalaf F. Alsharif, Ibrahim F. Halawani, Shiek S.S.J. Ahmed, Shankargouda Patil
      Journal of Genetic Engineering and Biotechnology.2023; 21(1): 82.     CrossRef
    • A rare case of Azathioprine-induced leukopenia in an European woman
      Wautier Séverine, De Koninck Xavier, Coche Jean-Charles
      Acta Clinica Belgica.2022; 77(1): 163.     CrossRef
    • NUDT15 is a key genetic factor for prediction of hematotoxicity in pediatric patients who received a standard low dosage regimen of 6-mercaptopurine
      Kanyarat Khaeso, Patcharee Komvilaisak, Su-on Chainansamit, Nontaya Nakkam, Kunanya Suwannaying, Pitchayanan Kuwatjanakul, Keiko Hikino, Areerat Dornsena, Sirimas Kanjanawart, Napat Laoaroon, Suda Vannaprasaht, Takeshi Taketani, Wichittra Tassaneeyakul
      Drug Metabolism and Pharmacokinetics.2022; 43: 100436.     CrossRef
    • Nudix Hydroxylase 15 Mutations Strongly Predict Thiopurine-Induced Leukopenia Across Different Asian Ethnicities: Implications for Screening in a Diverse Population
      Xin-Hui Khoo, Shin Yee Wong, Nik Razima Wan Ibrahim, Ruey Terng Ng, Kee Seang Chew, Way Seah Lee, Zhi Qin Wong, Raja Affend Raja Ali, Shahreedhan Shahrani, Alex Hwong-Ruey Leow, Ida Normiha Hilmi
      Frontiers in Medicine.2022;[Epub]     CrossRef
    • NUDT15Genotyping in Thiopurine Drug Therapy
      Jong Kwon Lee, Rihwa Choi, Soo-Youn Lee
      Laboratory Medicine Online.2022; 12(4): 217.     CrossRef
    • Personalized medicine to implementation science: Thiopurines set for the leap
      Vishal Sharma, Saurabh Kedia, Vineet Ahuja
      JGH Open.2022; 6(10): 651.     CrossRef
    • Pharmacogenetic determinants of thiopurines in an Indian cohort
      Shaik Mohammad Naushad, Mekala Janaki Ramaiah, Vijay Kumar Kutala, Tajamul Hussain, Salman A. Alrokayan
      Pharmacological Reports.2021; 73(1): 278.     CrossRef
    • The Emerging Clinical Application of m6A RNA Modification in Inflammatory Bowel Disease and Its Associated Colorectal Cancer
      Xinwei Xu, Jintu Huang, Dickson Kofi Wiredu Ocansey, Yuxuan Xia, Zihan Zhao, Zhiwei Xu, Yongmin Yan, Xu Zhang, Fei Mao
      Journal of Inflammation Research.2021; Volume 14: 3289.     CrossRef
    • Importance of NUDT15 Polymorphisms in Thiopurine Treatments
      Yoichi Tanaka, Yoshiro Saito
      Journal of Personalized Medicine.2021; 11(8): 778.     CrossRef
    • Randomised clinical trial: dose optimising strategy by NUDT15 genotyping reduces leucopenia during thiopurine treatment of Crohn's disease
      Kang Chao, Yibiao Huang, Xia Zhu, Jian Tang, Xueding Wang, Lang Lin, Huili Guo, Caibin Zhang, Miao Li, Qingfan Yang, Jie Huang, Lingna Ye, Pinjin Hu, Min Huang, Qian Cao, Xiang Gao
      Alimentary Pharmacology & Therapeutics.2021; 54(9): 1124.     CrossRef
    • Meta-Analysis of NUDT15 Genetic Polymorphism on Thiopurine-Induced Myelosuppression in Asian Populations
      Kanyarat Khaeso, Sariya Udayachalerm, Patcharee Komvilaisak, Su-on Chainansamit, Kunanya Suwannaying, Napat Laoaroon, Pitchayanan Kuwatjanakul, Nontaya Nakkam, Chonlaphat Sukasem, Apichaya Puangpetch, Wichittra Tassaneeyakul, Nathorn Chaiyakunapruk
      Frontiers in Pharmacology.2021;[Epub]     CrossRef
    • High-resolution melt analysis enables simple genotyping of complicated polymorphisms of codon 18 rendering the NUDT15 diplotype
      Yoichi Kakuta, Yasuhiro Izumiyama, Daisuke Okamoto, Takeru Nakano, Ryo Ichikawa, Takeo Naito, Rintaro Moroi, Masatake Kuroha, Yoshitake Kanazawa, Tomoya Kimura, Hisashi Shiga, Hisaaki Kudo, Naoko Minegishi, Yosuke Kawai, Katsushi Tokunaga, Masao Nagasaki,
      Journal of Gastroenterology.2020; 55(1): 67.     CrossRef
    • An intronic FTO variant rs16952570 confers protection against thiopurine-induced myelotoxicities in multiethnic Asian IBD patients
      Sylvia Chen, Wei Zhi Tan, Natalia Sutiman, Cindy Lim, Sze Sing Lee, Wai Fook Leong, Madeline Tjai, Chunyan Wang, Chris San Choon Kong, Sai Wei Chuah, Brian John Schwender, Webber Chan, Hang Hock Shim, Wee Chian Lim, Chiea Chuen Khor, Khoon Lin Ling, Balra
      The Pharmacogenomics Journal.2020; 20(3): 505.     CrossRef
    • Precision therapy of 6‐mercaptopurine in Chinese children with acute lymphoblastic leukaemia
      Yue Zhou, Li Wang, Xiao‐Ying Zhai, Li Wen, Fang Tang, Fan Yang, Xi‐Ting Liu, Lei Dong, Li‐Juan Zhi, Hai‐Yan Shi, Guo‐Xiang Hao, Yi Zheng, Evelyne Jacqz‐Aigrain, Tian‐You Wang, Wei Zhao
      British Journal of Clinical Pharmacology.2020; 86(8): 1519.     CrossRef
    • NUDT15 gene variants and thiopurine-induced leukopenia in patients with inflammatory bowel disease
      Katsuyoshi Matsuoka
      Intestinal Research.2020; 18(3): 275.     CrossRef
    • Long‐term effect of NUDT15 R139C on hematologic indices in inflammatory bowel disease patients treated with thiopurine
      Shintaro Akiyama, Katsuyoshi Matsuoka, Kyoko Fukuda, Shunsuke Hamada, Mikiko Shimizu, Kosaku Nanki, Shinta Mizuno, Hiroki Kiyohara, Mari Arai, Shinya Sugimoto, Yasushi Iwao, Haruhiko Ogata, Tadakazu Hisamatsu, Makoto Naganuma, Maiko Motobayashi, Kohei Suz
      Journal of Gastroenterology and Hepatology.2019; 34(10): 1751.     CrossRef
    • Systematic review with meta‐analysis: risk factors for thiopurine‐induced leukopenia in IBD
      Sara van Gennep, Kadère Konté, Berrie Meijer, Martijn W. Heymans, Geert R. D’Haens, Mark Löwenberg, Nanne K. H. de Boer
      Alimentary Pharmacology & Therapeutics.2019; 50(5): 484.     CrossRef
    • Mycophenolate mofetil and prednisolone for cerebral sinus venous thrombosis with Behcet's disease
      Shintaro Terashita, Tomomi Tanaka, Hiromichi Taneichi, Yuichi Adachi, Masaaki Mori
      Pediatrics International.2019; 61(9): 920.     CrossRef
    • Behcet's Disease With Cerebral Artery Infarction Caused by Cerebral Arteritis as an Early Symptom Only With Elevated Interleukin-8
      Hao Yin, Yun Song, Meimei Zheng, Ju Han, Jiyou Tang
      Frontiers in Neurology.2019;[Epub]     CrossRef
    • Pharmacogenetics of thiopurines for inflammatory bowel disease in East Asia: prospects for clinical application of NUDT15 genotyping
      Yoichi Kakuta, Yoshitaka Kinouchi, Tooru Shimosegawa
      Journal of Gastroenterology.2018; 53(2): 172.     CrossRef
    • NUDT15 codon 139 is the best pharmacogenetic marker for predicting thiopurine-induced severe adverse events in Japanese patients with inflammatory bowel disease: a multicenter study
      Yoichi Kakuta, Yosuke Kawai, Daisuke Okamoto, Tetsuya Takagawa, Kentaro Ikeya, Hirotake Sakuraba, Atsushi Nishida, Shoko Nakagawa, Miki Miura, Takahiko Toyonaga, Kei Onodera, Masaru Shinozaki, Yoh Ishiguro, Shinta Mizuno, Masahiro Takahara, Shunichi Yanai
      Journal of Gastroenterology.2018; 53(9): 1065.     CrossRef
    • Severe thiopurine‐induced leukocytopenia and hair loss in Japanese patients with defective NUDT15 variant: Retrospective case–control study
      Mari Kishibe, Hiroyoshi Nozaki, Mizue Fujii, Shin Iinuma, Sawa Ohtsubo, Satomi Igawa, Kyoko Kanno, Masaru Honma, Kan Kishibe, Kensaku Okamoto, Akemi Ishida‐Yamamoto
      The Journal of Dermatology.2018; 45(10): 1160.     CrossRef
    • Diagnostic accuracy of NUDT15 gene variants for thiopurine-induced leukopenia: a systematic review and meta-analysis
      Sarah Cargnin, Armando A. Genazzani, Pier Luigi Canonico, Salvatore Terrazzino
      Pharmacological Research.2018; 135: 102.     CrossRef
    • A single‐center experience with methotrexate in the treatment of Chinese Crohn’s disease patients
      Tian Rong Wang, Yu Qi Qiao, Duo Wu Zou, Zhi Hua Ran
      Journal of Digestive Diseases.2018; 19(12): 753.     CrossRef

    • PubReader PubReader
    • ePub LinkePub Link
    • Cite
      CITE
      export Copy Download
      Close
      Download Citation
      Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

      Format:
      • RIS — For EndNote, ProCite, RefWorks, and most other reference management software
      • BibTeX — For JabRef, BibDesk, and other BibTeX-specific software
      Include:
      • Citation for the content below
      NUDT15, FTO, and RUNX1 genetic variants and thiopurine intolerance among Japanese patients with inflammatory bowel diseases
      Intest Res. 2017;15(3):328-337.   Published online June 12, 2017
      Close
    • XML DownloadXML Download
    Figure
    • 0
    • 1
    NUDT15, FTO, and RUNX1 genetic variants and thiopurine intolerance among Japanese patients with inflammatory bowel diseases
    Image Image
    Fig. 1 Interval from initiation to discontinuation of azathioprine among patients with gastrointestinal intolerance.
    Fig. 2 (A) Interval from initiation of thiopurine treatment to leukopenia development according to NUDT15 p.Arg139Cys genotype. (B) Association between NUDT15 p.Arg139Cys genotype and thiopurine dose tolerated.
    NUDT15, FTO, and RUNX1 genetic variants and thiopurine intolerance among Japanese patients with inflammatory bowel diseases

    Baseline Characteristics of Patients

    VariableTotalNo leukopeniaLeukopeniaP-valuea
    Sex (male/female)96/6460/41 (59.4/40.6)36/23 (61.0/39.0)0.8686
    Age (yr)40.3 (18–74)38.3 (18–74)43.6 (20–74)0.0069
    Body weight (kg)54.6 (37–90)53.7 (31–80)54.4 (38–77)0.6358
    Diagnosis0.2706
     CD8657 (66.3)29 (33.7)
     UC7244 (61.1)28 (38.9)
     IBDu101 (100.0)
     Intestinal Behçet101 (100.0)
    5-ASA015198 (64.9)53 (35.1)0.0767
    Prednisolone9459 (62.8)35 (37.2)0.9106
    Anti-TNF-α agent (infliximab or adalimumab)8962 (69.7)27 (30.3)0.0697
    AZA/6-MP123/3784/17 (83.2/16.8)39/20 (66.1/33.9)0.0135
    Initial AZA dose (mg/kg/day)0.759±0.2470.757±0.2290.764±0.2870.5760
    Initial 6-MP dose (mg/kg/day)0.316±0.1670.282±0.0980.331±0.1960.9680
    Follow-up period of thiopurine therapy (mo)43.6 (0.25–132.00)42.1 (0.25–132.00)46.0 (0.50–126.00)0.9965

    Values are presented as number (%), mean (range), or mean±SD.

    aNo leukopenia vs. leukopenia.

    IBDu, IBD unclassified; 5-ASA, 5-aminosalicylic acid; TNF-α, tumor necrosis factor α; AZA, azathioprine; 6-MP, 6-mercaptopurine.

    Genotype Frequencies in Variants of NUDT15, FTO, and RUNX1

    GenotypeTotal (n=160)CD (n=86)UC (n=72)IBDu (n=1)Intestinal Behçet (n=1)
    NUDT15 p.Val18_Val19insGlyVal
     -/-149 (93.1)80 (53.7)67 (45.0)1 (0.7)1 (0.7)
     -/GGAGTC11 (6.9)6 (54.5)5 (45.5)00
    NUDT15 p.Val18Ile
     G/G158 (98.8)85 (53.8)71 (44.9)1 (0.6)1 (0.6)
     G/A2 (1.2)1 (50.0)1 (50.0)00
    NUDT15 p.Arg139Cys
     C/C117 (73.1)68 (58.1)49 (41.9)00
     C/T35 (21.9)15 (42.9)18 (51.4)1 (2.9)1 (2.9)
     T/T8 (5.0)3 (37.5)5 (62.5)00
    NUDT15 p.Arg139His
     G/G160 (100.0)86 (53.8)72 (45.0)1 (0.6)1 (0.6)
     G/A00000
    FTO p.Ala134Thr
     G/G151 (94.3)82 (54.3)68 (45.0)1 (0.7)0
     G/A9 (5.6)4 (44.4)4 (44.4)01 (11.1)
    RUNX1intergenic (rs2834826)
     C/C60 (37.5)31 (51.7)29 (48.3)00
     C/T80 (50.0)45 (56.3)33 (41.3)1 (1.3)1 (1.3)
     T/T20 (12.5)10 (50.0)10 (50.0)00

    Values are presented as number (%).

    IBDu, IBD unclassified.

    No Correlation between NUDT15 Genotypes and the Incidence of GI Intolerance to Azathioprine

    GeneNUDT15
    Coding SNP (location)p.Val18_Val19insGlyVal (exon 1)p.Val18Ile (exon 1)p.Arg139Cys (exon 3)
    Type of variants6-bp insertionP-valueMissenseP-valueMissenseP-value
    Genotype-/--/GGAGTCG/GG/AC/CC/TT/T
    No. of patients116 (94.3)7 (5.7)121 (98.4)2 (1.6)93 (75.6)22 (17.9)8 (6.5)
    Male/female66/506/171/501/154/3913/95/3
    No GI intolerance107 (94.7)6 (5.3)111 (98.2)2 (1.8)86 (76.1)20 (17.7)7 (6.2)
    GI intolerance9 (90.0)1 (10.0)0.456210 (100.0)0-7 (70.0)2 (20.0)1 (10.0)0.8706

    Values are presented as number (%).

    GI, gastrointestinal; SNP, single nucleotide polymorphism.

    Associations between NUDT15 Genotype and Leukopenia and Severe Hair Loss

    GeneNUDT15
    Coding SNP (location)p.Val18_Val19insGlyVal (exon 1)p.Val18Ile (exon 1)p.Arg139Cys (exon 3)
    Type of variants6-bp insertionP-valueMissenseP-valueMissenseP-value
    Genotype-/--/GGAGTCG/GG/AC/CC/TT/T
    No. of patients139 (93.3)10 (6.7)147 (98.7)2 (1.3)109 (73.2)33 (22.1)7 (4.7)
    Male/female82/578/289/581/165/4421/124/3
    No leukopenia87 (96.7)3 (3.3)90 (100.0)080 (88.8)9 (10.0)1 (1.1)
    Leukopenia52 (88.1)7 (11.9)0.051257 (96.6)2 (3.4)0.155229 (49.1)24 (40.7)6 (10.2)<0.0001
     Early leukopenia14 (87.5)2 (12.5)0.162916 (100.0)0-3 (18.7)8 (50.0)5 (31.3)<0.0001
     Late leukopenia38 (88.4)5 (11.6)0.111341 (95.3)2 (4.7)0.102926 (60.5)16 (37.2)1 (2.3)0.0006
    No severe hair loss132 (93.0)10 (7.0)140 (98.6)2 (1.4)109 (76.8)33 (23.2)0
    Severe hair loss7 (100.0)0-7 (100.0)0-007 (100.0)<0.0001

    Values are presented as number (%).

    SNP, single nucleotide polymorphism.

    No association of FTO and RUNX1 with Leukopenia and Severe Hair Loss in a Japanese Population

    GeneFTORUNX1
    SNP (location)p.Ala134Thr (exon 3)RUNX1 intergenic (rs2834826)
    Type of variantsMissenseP-valueNon coding variantP-value
    GenotypeG/GA/GC/CC/TT/T
    No. of patients140 (94.0)9 (6.0)56 (37.6)73 (49.0)20 (13.4)
    Male/female84/566/335/2146/279/11
    No leukopenia85 (94.4)5 (5.6)33 (36.7)47 (52.2)10 (11.1)
    Leukopenia55 (93.2)4 (6.8)0.740423 (39.0)26 (44.1)10 (16.9)0.4869
     Early leukopenia15 (93.7)1 (6.3)-5 (31.2)8 (50.0)3 (18.8)0.6803
     Late leukopenia40 (93.0)3 (7.0)0.713018 (41.9)18 (41.9)7 (16.3)0.4839
    No severe hair loss133 (93.7)9 (6.3)52 (36.6)71 (50.0)19 (13.4)
    Severe hair loss7 (100.0)04 (57.1)2 (28.6)1 (14.3)0.5023

    Values are presented as number (%).

    SNP, single nucleotide polymorphism.

    Table 1 Baseline Characteristics of Patients

    Values are presented as number (%), mean (range), or mean±SD.

    aNo leukopenia vs. leukopenia.

    IBDu, IBD unclassified; 5-ASA, 5-aminosalicylic acid; TNF-α, tumor necrosis factor α; AZA, azathioprine; 6-MP, 6-mercaptopurine.

    Table 2 Genotype Frequencies in Variants of NUDT15, FTO, and RUNX1

    Values are presented as number (%).

    IBDu, IBD unclassified.

    Table 3 No Correlation between NUDT15 Genotypes and the Incidence of GI Intolerance to Azathioprine

    Values are presented as number (%).

    GI, gastrointestinal; SNP, single nucleotide polymorphism.

    Table 4 Associations between NUDT15 Genotype and Leukopenia and Severe Hair Loss

    Values are presented as number (%).

    SNP, single nucleotide polymorphism.

    Table 5 No association of FTO and RUNX1 with Leukopenia and Severe Hair Loss in a Japanese Population

    Values are presented as number (%).

    SNP, single nucleotide polymorphism.


    Intest Res : Intestinal Research
    Close layer
    TOP