Skip Navigation
Skip to contents

Intest Res : Intestinal Research

IMPACT FACTOR

Articles

Page Path
HOME > Intest Res > Volume 15(4); 2017 > Article
Original Article Is methylation analysis of SFRP2, TFPI2, NDRG4, and BMP3 promoters suitable for colorectal cancer screening in the Korean population?
Soo-Kyung Park1,2, Hae Lim Baek1, Junghee Yu1, Ji Yeon Kim3, Hyo-Joon Yang1,2, Yoon Suk Jung1,2, Kyu Yong Choi1,2, Hungdai Kim2,4, Hyung Ook Kim2,4, Kyung Uk Jeong2,4, Ho-Kyung Chun2,4, Kyungeun Kim2,5, Dong Il Park1,2
Intestinal Research 2017;15(4):495-501.
DOI: https://doi.org/10.5217/ir.2017.15.4.495
Published online: October 23, 2017

1Division of Gastroenterology, Department of Internal Medicine, Kangbuk Samsung Hospital, Sungkyunkwan University School of Medicine, Seoul, Korea.

2Gastrointestinal Cancer Center, Kangbuk Samsung Hospital, Sungkyunkwan University School of Medicine, Seoul, Korea.

3Comprehensive Health Care Center, Korea Cancer Center Hospital, Korea Institute of Radiological & Medical Sciences, Seoul, Korea.

4Department of Surgery, Kangbuk Samsung Hospital, Sungkyunkwan University School of Medicine, Seoul, Korea.

5Department of Pathology, Kangbuk Samsung Hospital, Sungkyunkwan University School of Medicine, Seoul, Korea.

Correspondence to Dong Il Park, Division of Gastroenterology, Department of Internal Medicine, Kangbuk Samsung Hospital, Sungkyunkwan University School of Medicine, 29 Saemunan-ro, Jongno-gu, Seoul 03181, Korea. Tel: +82-2-2001-2059, Fax: +82-2-2001-2049, diksmc.park@samsung.com
*These authors contributed equally to this study.
• Received: December 13, 2016   • Revised: March 10, 2017   • Accepted: March 20, 2017

© Copyright 2017. Korean Association for the Study of Intestinal Diseases.

This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

prev next
  • 10,155 Views
  • 103 Download
  • 34 Web of Science
  • 32 Crossref
  • 46 Scopus
  • Background/Aims
    Colorectal cancer (CRC) screening using stool DNA was recently found to yield good detection rates. A multi-target stool DNA test (Cologuard®, Exact Sciences), including methylated genes has been recently approved by the U.S. Food and Drug Administration. The aim of this study was to validate these aberrantly methylated genes as stool-based DNA markers for detecting CRC and colorectal advanced adenoma (AA) in the Korean population.
  • Methods
    A single-center study was conducted in 36 patients with AA; 35 patients with CRC; and 40 endoscopically diagnosed healthy controls using CRC screening colonoscopy. The methylation status of the SFRP2, TFPI2, NDRG4, and BMP3 promoters was investigated blindly using bisulfate-modified stool DNA obtained from 111 participants. Methylation status was investigated by methylation-specific polymerase chain reaction.
  • Results
    Methylated SFRP2, TFPI2, NDRG4, and BMP3 promoters were detected in 60.0%, 31.4%, 68.8%, and 40.0% of CRC samples and in 27.8%, 27.8%, 27.8%, and 33.3% of AA samples, respectively. The sensitivities obtained using 4 markers to detect CRC and AA were 94.3% and 72.2%, respectively. The specificity was 55.0%.
  • Conclusions
    Our results demonstrate that the SFRP2, TFPI2, NDRG4, and BMP3 promoter methylation analysis of stool sample DNA showed high sensitivity but low specificity for detecting CRC and AA. Because of the low specificity, 4 methylated markers might not be sufficient for CRC screening in the Korean population. Further large-scale studies are required to validate the methylation of these markers in the Asian population and to find new markers for the Asian population.
Colorectal cancer (CRC) is the 3rd most common cancer worldwide,1 and the incidence and mortality rates of CRC are increasing in Korea.2 The prevention of CRC by screening relies on the effective detection of critical precursor lesions, and thus broadly applied preventive and early detection measures are needed.34
In addition to traditional screening methods of CRC, including fecal occult blood test (FOBT) and colonoscopy, stool DNA testing has emerged as a noninvasive, molecular approach for CRC screening.5 Epigenetic alterations in CRC, such as aberrant DNA methylation have been extensively studied; thus, DNA methylation in exfoliated human gastrointestinal cells in stool may serve as a CRC biomarker.6789 A multitarget stool DNA test, including methylated genes, has been recently approved by the U.S. Food and Drug Administration (USFDA).10 However, the results of the latest study showed a higher rate of false-positive results,11 and few validation studies have been conducted in Asia, including Korea.12
In the present study, we aimed to investigate stool-based methylated DNA markers for detecting CRC and precancerous lesions in Korean patients, and selected 4 previously identified promoters, including secreted frizzled-related protein 2 (SFRP2), tissue factor pathway inhibitor 2 (TFPI2), N-myc downstream-regulated gene 4 (NDRG4), and bone morphogenetic protein 3 (BMP3).
1. Patients
This study included 111 patients who underwent colonoscopy for CRC screening at the Kangbuk Samsung Hospital between August 2012 and March 2014. Of these, 36 and 35 patients were diagnosed with advanced adenoma (AA) and CRC, respectively. A control group consisting of 40 endoscopically diagnosed healthy participants was also included in the study. Exclusion criteria were prior colorectal resection, history of any cancer, clinically apparent polyposis syndrome or hereditary nonpolyposis colon cancer syndrome, incomplete colonoscopic examination, and refusal of consent. All participants provided written informed consent and provided sufficient stool samples for DNA isolation using a self-collection approach. This study was approved by the Institutional Review Board of Kangbuk Samsung Hospital (IRB No. 2013-01-135), South Korea.
2. Colonoscopy and Definitions
All polypoid lesions were removed during colonoscopy. The size of each polyp was estimated using open-biopsy forceps that were 7 mm in diameter. All retrieved polyps were sent to the pathology laboratory for histologic evaluation. AA refers to adenomas with diameter ≥10 mm or tubulovillous, villous, or high-grade dysplasia. Patients with intramucosal carcinomas or carcinomas in situ were designated as having high-grade dysplasia. Cancer was defined as the invasion of malignant cells beyond the muscularis mucosa. If one patient had more than 1 lesion, the most advanced lesion was selected for further analysis. The left colon was defined as the rectum, sigmoid, and descending colon, whereas the right colon was defined as the transverse colon, ascending colon, and cecum.
3. Stool DNA Extraction from Stool Samples and Methylation-Specific PCR
Stool samples were collected the day before the colonoscopy (first stool during bowel preparation). Pre-endoscopy stool samples were stored in the patients' household freezers, and the patients were instructed to return the stool samples on the day of endoscopy for long-term storage at −70℃ in our laboratory.
Stool samples were randomly coded before processing to ensure adequate blinding of the clinical information. DNA was purified from feces (250–300 mg) using QIAamp DNA stool mini kit (Qiagen, Hilden, Germany) based on the manufacturer's instructions. This kit is designed for the preferential isolation and purification of DNA from human colonocytes present in the feces. PCR was performed to amplify the human β-actin gene to determine the quality of the isolated DNA. Human β-actin DNA was successfully amplified in all stool samples, confirming that our storage protocol for the samples was appropriate.
Genomic DNA was chemically modified with sodium bisulfite to convert all unmethylated cytosine residues to uracil while leaving the methylated cytosine residues unaltered. Methylation of the SFRP2, TFPI2, NDRG4, and BMP3 promoters in the bisulfite-modified DNA was investigated using methylation-specific PCR (MSP), aimed at either the methylated or the unmethylated alleles. Previously reported primer sequences are listed in Table 1, and commercially available methylated human genomic DNA (CpGenome Universal Methylated DNA; Chemicon International Inc., Temecula, CA, USA) was used as a positive control. The reagents without the isolated DNA served as the negative control. The thermocycler conditions were as follows: 95℃ for 5 minutes, 40 to 45 cycles at 95℃ for 30 seconds at a specific annealing temperature, and final extension at 72℃ for 10 minutes. All MSP assays were repeated at least twice to validate the results. Subsequently, MSP products were separated by horizontal gel electrophoresis in a 1.2% agarose gel, staining with ethidium bromide, and visualization under UV transillumination using the Quantity One image analyzer system (Bio-Rad, Hercules, CA, USA).
4. Statistical Analysis
Continuous variables were expressed as mean±SD, and comparisons between groups were performed using one-way ANOVA. Variables not normally distributed were compared using Kruskal-Wallis test. Categorical variables were expressed as percentages, and comparisons between groups were performed using chi-square test. The sensitivity and specificity (including 95% CI) of the stool DNA assay were calculated using a manual method. The sensitivity and specificity were reported for each marker and combination of the 4 markers, which was defined as at least 1 methylation among the SFRP2, TFPI2, NDRG4, and BMP3 promoters. P-values <0.05 were considered significant. All data analyses were performed using SPSS version 18.0 (SPSS Inc., Chicago, IL, USA).
1. Patients
The stool samples were obtained from 40 endoscopically diagnosed healthy controls, 36 patients with AA, and 35 patients with CRC. The mean age was 55.7 years in normal patients, 63.2 years in patients with AA, and 60.6 years in patients with CRC, showing a statistically significant difference (P=0.03). No significant differences were found between sexes (Table 2).
2. Hypermethylation of SFRP2, TFPI2, NDRG4, and BMP3 Promoters in Patients with CRC
MSP was performed in 35 patients with CRC (Fig. 1). Methylation of the SFRP2, TFPI2, NDRG4, and BMP3 promoters was detected in 21 (60.0%), 11 (31.4%), 24 (68.8%), and 14 (40.0%) CRC samples, respectively. The sensitivity of combination of the 4 markers for detecting CRC was 94.3% (95% CI, 86.2–100.0) (Table 3).
In patients with CRC, the sensitivity using a combination of the 4 markers in left-sided CRC was 95.7%, and this difference was not significant compared with the sensitivity in right-sided CRC. The sensitivity of combination of the 4 markers in patients with stage III/IV CRC was 100%, but the sensitivity did not vary significantly based on CRC stage (Table 4).
3. Hypermethylation of SFRP2, TFPI2, NDRG4, and BMP3 Promoters in Patients with AA
MSP was performed in 36 patients with AA. Methylation of the SFRP2, TFPI2, NDRG4, and BMP3 promoters was detected in 10 (27.8%), 10 (27.8%), 10 (27.8%), and 12 (33.3%) of the AA samples, respectively. The sensitivity of combination of the 4 markers for detecting AA was 72.2% (95% CI, 43.0–77.0) (Table 3).
In patients with AA, the sensitivities of combination of the 4 markers for detecting adenoma with >10 mm, villous histology, and high-grade dysplasia were 74.3%, 74.1%, and 57.1%, respectively. No statistically significant association was found between stool DNA hypermethylation and size, histology, or dysplasia (Table 4).
4. Hypermethylation of SFRP2, TFPI2, NDRG4, and BMP3 Promoters in Normal Patients
MSP was performed in 40 normal patients (Fig. 1). Methylation of the SFRP2, TFPI2, NDRG4, and BMP3 promoters was detected in 5 (12.5%), 4 (10%), 8 (20%), and 6 (15%) normal patients. Thus, their specificities were 87.5%, 90.0%, 80.0%, and 85.0%, respectively. The specificity of combination of the 4 markers for detecting CRC or AA was 55.0% (Table 3). When we compared the clinical characteristics in patients with true negative (n=22) and false negative (n=10) using combination of the 4 markers, no difference was found in the proportion of male patients (60.0% vs. 72.7%, P=0.47) and the mean age (57.1±13.7 years vs. 53.9±16.6 years, P=0.67).
In this study, we investigated the feasibility of detecting methylated stool DNA as a screening tool for CRC and precancerous lesions (AA). Using 4 methylation markers (SFRP2, TFPI2, NDRG4, and BMP3), 94.3% of patients with CRC and 72.2% of patients with AA showed methylated DNA in their stool samples. However, the specificity of our testing method was only 55.0%.
In analyzing different screening tests for CRC, the sensitivity, specificity, and particularly compliance must be considered. A screening test must not only be accurate, but also be widely accessible to provide effective lesion detection at a population level. To screen for CRC using stool samples, FOBT is widely performed and is the only screening method shown to reduce the mortality rate of CRC.13 However, FOBT has limitations, such as interference by dietary components, low sensitivity, and the requirement of multiple samplings.14 Assaying stool DNA for CRC screening has the advantages of continuous marker release and production from the neoplasm with better sensitivity than FOBT.15 Furthermore, the detection accuracy of stool DNA testing is not affected by the anatomic site of the target lesions16 and is not affected by diet components.17 Therefore, the acceptance and compliance for stool DNA testing are likely to be superior to those of FOBT.
The feasibility of testing stool DNA to screen for CRC was initially examined using mutation-based DNA, such as mutant KRAS.18 Methylation-based testing, involving the use of specific markers that are representative of an epigenetic signature of neoplastic alterations has been recently examined.14 A Cologuard® (Exact Sciences, Madison, WI, USA), a multitarget stool DNA test, including molecular assays for aberrantly methylated BMP3 and NDRG4 gene promoter regions, has been recently approved by the USFDA.10
In our study, we selected 4 methylation markers, SFRP2, TFPI2, NDRG4, and BMP3, which are known to be involved in CRC and were included in a recent multitarget stool DNA test.311 SFRP2 is a tumor suppressor gene, and its protein product contains domains similar to those in Wnt-receptor frizzled proteins. Promoter hypermethylation induces epigenetic inactivation of SFRP2 by constitutive Wnt signaling, which is observed in approximately 90% of CRC cases.1920 In previous studies, the sensitivity and specificity of a single marker for SFRP2 in CRC patient stool samples were 63% to 94% and 91% to 96%, respectively.14 TFPI2 is a tumor suppressor gene that may be predisposed to aberrant DNA methylation in CRC carcinogenesis.21 In a previous study, TFPI2 methylation was detected in stool DNA from CRC patients with sensitivity and specificity of 76% and 79%, respectively.21 NDRG4 is a tumor suppressor gene in CRC whose expression is frequently inactivated by promoter methylation. In stool DNA, methylated NDRG4 showed a sensitivity of 61% for detecting CRC, with a corresponding specificity of 93%.22 BMP3 is a transforming growth factor-β of cytokine, and aberrant hypermethylation of this gene has been reported to downregulate the expression of BMP3 in CRC.23 Although no studies have investigated methylated BMP3 in stool as a single marker for CRC detection, multi-target stool DNA assay to measure β-actin, mutant KRAS, methylated BMP3, and NDRG4 showed 90% specificity, with 98% sensitivity in patients with CRC.16
In the present study, although the specificity for each marker was as high as 80% to 90%, the specificity for the combined 4 markers was as low as 55%. If we only included 2 markers (BMP3 and NDRG4) similar to the previous study,11 specificity was increased to 70%. The reason for the high false-positive rate might be related with field effect, as we previously reported.24 However, although recently developed DNA panels include not only methylated promoters, but also mutant KRAS and an immunochemical assay for human hemoglobin,11 their specificity is lower than that for fecal immunochemical test (FIT), resulting in more false-positive results, more diagnostic colonoscopies, and more associated adverse events per screening test.25
This study had several strengths. We investigated methylated markers that were included in a multitarget stool DNA test, which has been recently approved by the USFDA, in the Asian population. In addition, the use of stool collected from well-characterized patients undergoing colonoscopy for average risk CRC screening in a blinded design, and specimens were uniformly collected and analyzed.
The limitations of this study include a relatively small number of specimens and age differences between groups. Because a previous study demonstrated the effect of age on methylation markers,7 a large study should be performed to examine the role of stool methylated DNA for CRC screening related with age. Second, we did not perform FOBT or FIT simultaneously. Third, because we collected the first stool during bowel preparation, the fecal specimen might have been contaminated with the bowel preparation solution, and it might have affected the sensitivity of a single target. Since a few stool DNA marker studies have been conducted in Asia, large studies investigating stool DNA markers and comparing sensitivity and specificity with FIT or FOBT in Asian populations are needed.
In conclusion, the combination of 4 methylated markers might not be sufficient for CRC screening in Korea because of the low specificity. Further studies are needed to validate the methylation of these markers in the Asian population.

Financial support: This work was supported by a Ferring grant of the Korean Association for the Study of Intestinal Diseases for 2008, and Medical Research Funds from Kangbuk Samsung Hospital and Hyoseok Medical Research Fund.

Conflict of interest: None.

  • 1. Jemal A, Siegel R, Ward E, et al. Cancer statistics, 2008. CA Cancer J Clin 2008;58:71–96.PMID: 18287387.ArticlePubMed
  • 2. Jung KW, Park S, Kong HJ, et al. Cancer statistics in Korea: incidence, mortality, survival, and prevalence in 2009. Cancer Res Treat 2012;44:11–24.PMID: 22500156.ArticlePubMedPMCPDF
  • 3. Ahlquist DA, Zou H, Domanico M, et al. Next-generation stool DNA test accurately detects colorectal cancer and large adenomas. Gastroenterology 2012;142:248–256.PMID: 22062357.ArticlePubMed
  • 4. Markowitz SD, Bertagnolli MM. Molecular origins of cancer: molecular basis of colorectal cancer. N Engl J Med 2009;361:2449–2460.PMID: 20018966.ArticlePubMedPMC
  • 5. Imperiale TF, Ransohoff DF, Itzkowitz SH, Turnbull BA, Ross ME, Colorectal Cancer Study Group. Fecal DNA versus fecal occult blood for colorectal-cancer screening in an average-risk population. N Engl J Med 2004;351:2704–2714.PMID: 15616205.ArticlePubMed
  • 6. Lansdorp-Vogelaar I, Kuntz KM, Knudsen AB, Wilschut JA, Zauber AG, van Ballegooijen M. Stool DNA testing to screen for colorectal cancer in the Medicare population: a cost-effectiveness analysis. Ann Intern Med 2010;153:368–377.PMID: 20855801.ArticlePubMedPMC
  • 7. Kim ER, Kim YH. Clinical application of genetics in management of colorectal cancer. Intest Res 2014;12:184–193.PMID: 25349592.ArticlePubMedPMC
  • 8. Nagasaka T, Tanaka N, Cullings HM, et al. Analysis of fecal DNA methylation to detect gastrointestinal neoplasia. J Natl Cancer Inst 2009;101:1244–1258.PMID: 19700653.ArticlePubMedPMCPDF
  • 9. De Maio G, Rengucci C, Zoli W, Calistri D. Circulating and stool nucleic acid analysis for colorectal cancer diagnosis. World J Gastroenterol 2014;20:957–967.PMID: 24574768.ArticlePubMedPMC
  • 10. A stool DNA test (Cologuard) for colorectal cancer screening. JAMA 2014;312:2566PMID: 25514307.ArticlePubMed
  • 11. Imperiale TF, Ransohoff DF, Itzkowitz SH, et al. Multitarget stool DNA testing for colorectal-cancer screening. N Engl J Med 2014;370:1287–1297.PMID: 24645800.ArticlePubMed
  • 12. Chang E, Park DI, Kim YJ, et al. Detection of colorectal neoplasm using promoter methylation of ITGA4, SFRP2, and p16 in stool samples: a preliminary report in Korean patients. Hepatogastroenterology 2010;57:720–727.PMID: 21033217.PubMed
  • 13. Mandel JS, Bond JH, Church TR, et al. Reducing mortality from colorectal cancer by screening for fecal occult blood: Minnesota Colon Cancer Control study. N Engl J Med 1993;328:1365–1371.PMID: 8474513.ArticlePubMed
  • 14. Ahlquist DA. Molecular detection of colorectal neoplasia. Gastroenterology 2010;138:2127–2139.PMID: 20420950.ArticlePubMed
  • 15. Osborn NK, Ahlquist DA. Stool screening for colorectal cancer: molecular approaches. Gastroenterology 2005;128:192–206.PMID: 15633136.ArticlePubMed
  • 16. Lidgard GP, Domanico MJ, Bruinsma JJ, et al. Clinical performance of an automated stool DNA assay for detection of colorectal neoplasia. Clin Gastroenterol Hepatol 2013;11:1313–1318.PMID: 23639600.ArticlePubMed
  • 17. Itzkowitz S, Brand R, Jandorf L, et al. A simplified, noninvasive stool DNA test for colorectal cancer detection. Am J Gastroenterol 2008;103:2862–2870.PMID: 18759824.ArticlePubMed
  • 18. Sidransky D, Tokino T, Hamilton SR, et al. Identification of ras oncogene mutations in the stool of patients with curable colorectal tumors. Science 1992;256:102–105.PMID: 1566048.ArticlePubMed
  • 19. Fodde R, Smits R, Clevers H. APC, signal transduction and genetic instability in colorectal cancer. Nat Rev Cancer 2001;1:55–67.PMID: 11900252.ArticlePubMedPDF
  • 20. Xu Q, D'Amore PA, Sokol SY. Functional and biochemical interactions of Wnts with FrzA, a secreted Wnt antagonist. Development 1998;125:4767–4776.PMID: 9806925.ArticlePubMedPDF
  • 21. Glöckner SC, Dhir M, Yi JM, et al. Methylation of TFPI2 in stool DNA: a potential novel biomarker for the detection of colorectal cancer. Cancer Res 2009;69:4691–4699.PMID: 19435926.ArticlePubMedPMC
  • 22. Melotte V, Lentjes MH, van den Bosch SM, et al. N-myc downstream-regulated gene 4 (NDRG4): a candidate tumor suppressor gene and potential biomarker for colorectal cancer. J Natl Cancer Inst 2009;101:916–927.PMID: 19535783.ArticlePubMedPDF
  • 23. Loh K, Chia JA, Greco S, et al. Bone morphogenic protein 3 inactivation is an early and frequent event in colorectal cancer development. Genes Chromosomes Cancer 2008;47:449–460.PMID: 18311777.ArticlePubMed
  • 24. Park SK, Song CS, Yang HJ, et al. Field cancerization in sporadic colon cancer. Gut Liver 2016;10:773–780.PMID: 27114416.ArticlePubMedPMCPDF
  • 25. US Preventive Services Task Force; Bibbins-Domingo K, Grossman DC, et al. Screening for colorectal cancer: US Preventive Services Task Force recommendation statement. JAMA 2016;315:2564–2575.PMID: 27304597.ArticlePubMed
Fig. 1

Results of the stool DNA methylation-specific PCR assay performed with samples obtained from patients with colorectal cancer (C) and advanced adenoma (A) and healthy controls (N). SFRP2, secreted frizzled-related protein 2; TFPI2, tissue factor pathway inhibitor 2; NDRG4, N-myc downstream-regulated gene 4; BMP3, bone morphogenetic protein 3.

ir-15-495-g001.jpg
Table 1

Primer Sequences, PCR Product Sizes, and Annealing Temperatures Used in MSP Assays

ir-15-495-i001.jpg
PCR product size (bp) Annealing temperature (℃)
SFRP2
 M S: GGGTCGGAGTTTTTCGGAGTTGCGC 138 62
 A: CCGCTCTCTTCGCTAAATACGACTCG
 U S: TTTTGGGTTGGAGTTTTTTGGAGTTGTGT 145 50
 A: AACCCACTCTCTTCACTAAATACAACTCA
BMP3
 M S: GTTTGGAGTTTAATTTTCGGTTTC 179 54
 A: ATAACTTCGATCTCTCTCCCTACG
 U S: GGTTTGGAGTTTAATTTTTGGTTTT 178 54
 A: AACTTCAATCTCTCTCCCTACACC
NDRG4
 M S: TTTAGGTTCGGTATCGTTTCGC 110 61
 A: CGAACTAAAAACGATACGCCG
 U S: GATTAGTTTTAGGTTTGGTATTGTTTTGT 105 61
 A: AAAACCAAACTAAAAACAATACACCA
TFPI2
 M S: ATTTTTTAGGTTTCGTTTCGGC 118 57
 A: GCCTAACGAAAAAAAATACGCG
 U S: TTAGTTATTTTTTAGGTTTTGTTTTGGT 105 57
 A: AAAAACACCTAACAAAAAAAAATACACA

MSP, methylation-specific PCR; SFRP2, secreted frizzled-related protein 2; M, methylated; S, sense; A, antisense; U, unmethylated; BMP3, bone morphogenetic protein 3; NDRG4, N-myc downstream-regulated gene 4; TFPI2, tissue factor pathway inhibitor 2.

Table 2

Characteristics of the Patients Enrolled in the Study

ir-15-495-i002.jpg
Colorectal cancer Advanced adenoma Normal P-value
No. of patients 35 36 40 -
Male sex 25 (62.5) 223 (65.7) 25 (69.4) 0.81
Age (yr) 60.60±13.04 63.20±10.16 55.70±14.64 0.03

Values are presented as number (%) or mean±SD.

Table 3

Sensitivity and Specificity of Methylated Stool DNA among Subgroups

ir-15-495-i003.jpg
SFRP2 TFPI2 NDRG4 BMP3 Combinationa
Colorectal cancer (n=35)
 No. of positive results 21 11 24 14 33
 Sensitivity (%) 60.0 31.4 68.8 40.0 94.3
 95% CI 43.0–77.0 15.0–48.0 52.0–85.0 23.0–57.0 86.2–100.0
Advanced adenoma (n=36)
 No. of positive results 10 10 10 12 26
 Sensitivity (%) 27.8 27.8 27.8 33.3 72.2
 95% CI 12.4–43.2 12.4–43.2 12.4–43.2 17.2–49.5 43.0–77.0
Normal (n=40)
 No. of positive results 5 4 8 6 18
 Specificity (%) 87.5 90.0 80.0 85.0 55.0
 95% CI 76.8–98.2 80.3–99.7 67.0–92.9 73.4–96.5 38.9–71.1

aHypermethylation of 1 of the 4 promoters (SFRP2, TFPI2, NDRG4, and BMP3).

SFRP2, secreted frizzled-related protein 2; TFPI2, tissue factor pathway inhibitor 2; NDRG4, N-myc downstream-regulated gene 4; BMP3, bone morphogenetic protein 3.

Table 4

Correlation between Clinicopathologic Findings and Sensitivity of Methylated Stool DNA

ir-15-495-i004.jpg
No. MSPa Sensitivity (%)b P-value
Colorectal cancer 35
 Location 0.99
  Right 12 11 91.7
  Left 23 22 95.7
 Stage 0.23
  I/II 17 15 88.2
  III/IV 18 18 100.0
Advanced adenoma 36
 Size (mm) 0.28
  >10 35 26 74.3
  ≤10 1 0 0
 Histology 0.68
  Villous 27 20 74.1
  Tubular 9 6 66.7
 Dysplasia 0.37
  High grade 7 4 57.1
  Low grade 29 22 75.9

aHypermethylation of 1 of the 4 promoters (SFRP2, TFPI2, NDRG4, and BMP3).

bCombination of 4 promoters (SFRP2, TFPI2, NDRG4, and BMP3).

MSP, methylation-specific PCR; SFRP2, secreted frizzled-related protein 2; TFPI2, tissue factor pathway inhibitor 2; NDRG4, N-myc downstream-regulated gene 4; BMP3, bone morphogenetic protein 3.

Figure & Data

REFERENCES

    Citations

    Citations to this article as recorded by  
    • Evolution of non-invasive colorectal neoplasm detection
      Sun Jung Kim, Tae-Gyun Lee, Jin-Min Jung, Chang Woo Kim
      World Journal of Gastrointestinal Oncology.2026;[Epub]     CrossRef
    • Methylation biomarkers for early detection of colorectal cancer: From molecular discovery to clinical translation and application
      Yangfeng Huang, Wei Jiang, Jianhong Kang
      Journal of Cancer Research and Therapeutics.2026; 22(2): 231.     CrossRef
    • Translational feasibility of a plasmonic microarray–based liquid biopsy for KRAS codon mutation detection across tissue, plasma, and urine in early colorectal cancer
      Ji Young Lee, Chae Won Mun, Eun Ran Kim, Sung-Gyu Park, Min-Young Lee
      npj Precision Oncology.2026;[Epub]     CrossRef
    • Effectiveness of single-target fecal DNA methylation test in regional mass screening for colorectal cancer and precancerous lesions in China
      Xianhe Kong, Qiuning Wu, Zhi Zhang, Zhiqiang Yu, Feng Niu, Xianshu Wang, Hongzhi Zou
      Gastroenterology Report.2025;[Epub]     CrossRef
    • Diagnostic value of genetic and epigenetic biomarker panels for colorectal cancer detection: a systematic review
      Georgios Alampritis, Sarah Nohelia Thoukididou, Maria Ramos, Pantelis Georgiou, Melpomeni Kalofonou, Constantinos Simillis
      International Journal of Colorectal Disease.2025;[Epub]     CrossRef
    • Advances in colorectal cancer screening: technological innovations, guideline discrepancies, and individualized strategies
      Li Tang, Xiaoyong Zhao, Guohong Wang, Jiehao Huang, Mu Zhang, Wei Xu
      Frontiers in Oncology.2025;[Epub]     CrossRef
    • DNA methylation modulates epigenetic regulation in colorectal cancer diagnosis, prognosis and precision medicine
      Jingxin Ye, Jianfeng Zhang, Weifeng Ding
      Exploration of Targeted Anti-tumor Therapy.2024; 5(1): 34.     CrossRef
    • Pathogenesis and biomarkers of colorectal cancer by epigenetic alteration
      Chang Kyo Oh, Young-Seok Cho
      Intestinal Research.2024; 22(2): 131.     CrossRef
    • Tissue factor pathway inhibitor-2 (TFPI-2)—an underappreciated partaker in cancer and metastasis
      Marek Z. Wojtukiewicz, Marta Mysliwiec, Anna Tokajuk, Joanna Kruszewska, Barbara Politynska, Anmbreen Jamroze, Anna M. Wojtukiewicz, Dean G. Tang, Kenneth V. Honn
      Cancer and Metastasis Reviews.2024; 43(4): 1185.     CrossRef
    • Detecting colorectal cancer using genetic and epigenetic biomarkers: screening and diagnosis
      Yudith Annisa Ayu Rezkitha, Nur Syahadati Retno Panenggak, Maria Inge Lusida, Raissa Virgy Rianda, Isna Mahmudah, Aditya Doni Pradana, Tomohisa Uchida, Muhammad Miftahussurur
      Journal of Medicine and Life.2024; 17(1): 4.     CrossRef
    • In Silico Gene Prioritization Highlights the Significance of Bone Morphogenetic Protein 4 (BMP4) Promoter Methylation across All Methylation Clusters in Colorectal Cancer
      Daša Jevšinek Skok, Nina Hauptman
      International Journal of Molecular Sciences.2023; 24(16): 12692.     CrossRef
    • Novel biomarkers used for early diagnosis and tyrosine kinase inhibitors as targeted therapies in colorectal cancer
      Huafeng Jiang, Senjun Zhou, Gang Li
      Frontiers in Pharmacology.2023;[Epub]     CrossRef
    • A novel screening method of DNA methylation biomarkers helps to improve the detection of colorectal cancer and precancerous lesions
      Yuan Li, Bin Li, Rou Jiang, Leen Liao, Chunting Zheng, Jie Yuan, Liuhong Zeng, Kunling Hu, Yuyu Zhang, Weijian Mei, Zhigang Hong, Binyi Xiao, Lingheng Kong, Kai Han, Jinghua Tang, Wu Jiang, Zhizhong Pan, Shenyan Zhang, Peirong Ding
      Cancer Medicine.2023; 12(21): 20626.     CrossRef
    • Current Research on Molecular Biomarkers for Colorectal Cancer in Stool Samples
      Patricio Órdenes, Claudio Carril Pardo, Roberto Elizondo-Vega, Karina Oyarce
      Biology.2023; 13(1): 15.     CrossRef
    • Beyond liquid biopsy: Toward non-invasive assays for distanced cancer diagnostics in pandemics
      Francesco Ferrara, Sofia Zoupanou, Elisabetta Primiceri, Zulfiqur Ali, Maria Serena Chiriacò
      Biosensors and Bioelectronics.2022; 196: 113698.     CrossRef
    • Novel Diagnostic Biomarkers in Colorectal Cancer
      Aneta L. Zygulska, Piotr Pierzchalski
      International Journal of Molecular Sciences.2022; 23(2): 852.     CrossRef
    • Diagnostic accuracy of multitarget stool DNA testing for colorectal cancer screening: A systematic review and meta-analysis
      Roya Dolatkhah, Saeed Dastgiri, Mohammad Asghari Jafarabadi, Hossein Mashhadi Abdolahi, Mohammad Hossein Somi
      Gastroenterología y Hepatología.2022; 45(10): 753.     CrossRef
    • Technical considerations in PCR-based assay design for diagnostic DNA methylation cancer biomarkers
      Maartje Massen, Kim Lommen, Kim A. D. Wouters, Johan Vandersmissen, Wim van Criekinge, James G. Herman, Veerle Melotte, Leo J. Schouten, Manon van Engeland, Kim M. Smits
      Clinical Epigenetics.2022;[Epub]     CrossRef
    • DNA methylation biomarkers in colorectal cancer: Clinical applications for precision medicine
      Nayeralsadat Fatemi, Sascha Tierling, Hamidreza Aboulkheyr Es, Maryam Varkiani, Ehsan Nazemalhosseini Mojarad, Hamid Asadzadeh Aghdaei, Jörn Walter, Mehdi Totonchi
      International Journal of Cancer.2022; 151(12): 2068.     CrossRef
    • Diagnostic accuracy of multitarget stool DNA testing for colorectal cancer screening: A systematic review and meta-analysis
      Roya Dolatkhah, Saeed Dastgiri, Mohammad Asghari Jafarabadi, Hossein Mashhadi Abdolahi, Mohammad Hossein Somi
      Gastroenterología y Hepatología (English Edition).2022; 45(10): 753.     CrossRef
    • Performance evaluation of stool DNA methylation tests in colorectal cancer screening: a systematic review and meta‐analysis
      Mahir Gachabayov, Edward Lebovics, Aram Rojas, Daniel M Felsenreich, Rifat Latifi, Roberto Bergamaschi
      Colorectal Disease.2021; 23(5): 1030.     CrossRef
    • Fecal Multidimensional Assay for Non-Invasive Detection of Colorectal Cancer: Fecal Immunochemical Test, Stool DNA Mutation, Methylation, and Intestinal Bacteria Analysis
      Shaobo Mo, Hui Wang, Lingyu Han, Wenqiang Xiang, Weixing Dai, Pengfei Zhao, Fengchun Pei, Zhixi Su, Chengcheng Ma, Qi Li, Zhimin Wang, Sanjun Cai, Hao Wang, Rui Liu, Guoxiang Cai
      Frontiers in Oncology.2021;[Epub]     CrossRef
    • Identification of DNA methylation markers for early detection of CRC indicates a role for nervous system-related genes in CRC
      Glenn Rademakers, Maartje Massen, Alexander Koch, Muriel X. Draht, Nikkie Buekers, Kim A. D. Wouters, Nathalie Vaes, Tim De Meyer, Beatriz Carvalho, Gerrit A. Meijer, James G. Herman, Kim M. Smits, Manon van Engeland, Veerle Melotte
      Clinical Epigenetics.2021;[Epub]     CrossRef
    • Advances in Early Detection of Colorectal Cancer: A Focus on Non-invasive Biomarkers
      Nadia El Kadmiri
      Current Drug Targets.2021; 22(9): 1043.     CrossRef
    • RETRACTED: Using Comorbidity Pattern Analysis to Detect Reliable Methylated Genes in Colorectal Cancer Verified by Stool DNA Test
      Yi-Chiao Cheng, Po-Hsien Wu, Yen-Ju Chen, Cing-Han Yang, Jhen-Li Huang, Yu-Ching Chou, Pi-Kai Chang, Chia-Cheng Wen, Shu-Wen Jao, Hsin-Hui Huang, Yi-Hsuan Tsai, Tun-Wen Pai
      Genes.2021; 12(10): 1539.     CrossRef
    • Plausibility of an extensive use of stool DNA test for screening advanced colorectal neoplasia
      Jiayi Mu, Yanqin Huang, Shanrong Cai, Qilong Li, Yongmao Song, Ying Yuan, Suzhan Zhang, Shu Zheng
      Clinica Chimica Acta.2020; 501: 42.     CrossRef
    • Epigenetics of colorectal cancer: biomarker and therapeutic potential
      Gerhard Jung, Eva Hernández-Illán, Leticia Moreira, Francesc Balaguer, Ajay Goel
      Nature Reviews Gastroenterology & Hepatology.2020; 17(2): 111.     CrossRef
    • Novel biomarkers for the diagnosis and prognosis of colorectal cancer
      Hyung-Hoon Oh, Young-Eun Joo
      Intestinal Research.2020; 18(2): 168.     CrossRef
    • Fecal DNA methylation markers for detecting stages of colorectal cancer and its precursors: a systematic review
      Janhavi R. Raut, Zhong Guan, Petra Schrotz-King, Hermann Brenner
      Clinical Epigenetics.2020;[Epub]     CrossRef
    • Hypermethylated Promoters of Secreted Frizzled-Related Protein Genes are Associated with Colorectal Cancer
      Haochang Hu, Tiangong Wang, Ranran Pan, Yong Yang, Bin Li, Cong Zhou, Jun Zhao, Yi Huang, Shiwei Duan
      Pathology & Oncology Research.2019; 25(2): 567.     CrossRef
    • BMP3 promoter hypermethylation in plasma-derived cell-free DNA in colorectal cancer patients
      Parisa Rokni, Afsaneh Mojtabanezhad Shariatpanahi, Ebrahim Sakhinia, Mohammad Amin Kerachian
      Genes & Genomics.2018; 40(4): 423.     CrossRef
    • Syndecan-2 Methylation as a New Biomarker for Early Detection of Colorectal Neoplasm
      Ji Hyun Kim, Sung Chul Park
      Gut and Liver.2018; 12(5): 479.     CrossRef

    • PubReader PubReader
    • ePub LinkePub Link
    • Cite
      CITE
      export Copy Download
      Close
      Download Citation
      Download a citation file in RIS format that can be imported by all major citation management software, including EndNote, ProCite, RefWorks, and Reference Manager.

      Format:
      • RIS — For EndNote, ProCite, RefWorks, and most other reference management software
      • BibTeX — For JabRef, BibDesk, and other BibTeX-specific software
      Include:
      • Citation for the content below
      Is methylation analysis of SFRP2, TFPI2, NDRG4, and BMP3 promoters suitable for colorectal cancer screening in the Korean population?
      Intest Res. 2017;15(4):495-501.   Published online October 23, 2017
      Close
    • XML DownloadXML Download
    Figure
    • 0
    Is methylation analysis of SFRP2, TFPI2, NDRG4, and BMP3 promoters suitable for colorectal cancer screening in the Korean population?
    Image
    Fig. 1 Results of the stool DNA methylation-specific PCR assay performed with samples obtained from patients with colorectal cancer (C) and advanced adenoma (A) and healthy controls (N). SFRP2, secreted frizzled-related protein 2; TFPI2, tissue factor pathway inhibitor 2; NDRG4, N-myc downstream-regulated gene 4; BMP3, bone morphogenetic protein 3.
    Is methylation analysis of SFRP2, TFPI2, NDRG4, and BMP3 promoters suitable for colorectal cancer screening in the Korean population?

    Primer Sequences, PCR Product Sizes, and Annealing Temperatures Used in MSP Assays

    PCR product size (bp)Annealing temperature (℃)
    SFRP2
     M S: GGGTCGGAGTTTTTCGGAGTTGCGC13862
     A: CCGCTCTCTTCGCTAAATACGACTCG
     U S: TTTTGGGTTGGAGTTTTTTGGAGTTGTGT14550
     A: AACCCACTCTCTTCACTAAATACAACTCA
    BMP3
     M S: GTTTGGAGTTTAATTTTCGGTTTC17954
     A: ATAACTTCGATCTCTCTCCCTACG
     U S: GGTTTGGAGTTTAATTTTTGGTTTT17854
     A: AACTTCAATCTCTCTCCCTACACC
    NDRG4
     M S: TTTAGGTTCGGTATCGTTTCGC11061
     A: CGAACTAAAAACGATACGCCG
     U S: GATTAGTTTTAGGTTTGGTATTGTTTTGT10561
     A: AAAACCAAACTAAAAACAATACACCA
    TFPI2
     M S: ATTTTTTAGGTTTCGTTTCGGC11857
     A: GCCTAACGAAAAAAAATACGCG
     U S: TTAGTTATTTTTTAGGTTTTGTTTTGGT10557
     A: AAAAACACCTAACAAAAAAAAATACACA

    MSP, methylation-specific PCR; SFRP2, secreted frizzled-related protein 2; M, methylated; S, sense; A, antisense; U, unmethylated; BMP3, bone morphogenetic protein 3; NDRG4, N-myc downstream-regulated gene 4; TFPI2, tissue factor pathway inhibitor 2.

    Characteristics of the Patients Enrolled in the Study

    Colorectal cancerAdvanced adenomaNormalP-value
    No. of patients353640-
    Male sex25 (62.5)223 (65.7)25 (69.4)0.81
    Age (yr)60.60±13.0463.20±10.1655.70±14.640.03

    Values are presented as number (%) or mean±SD.

    Sensitivity and Specificity of Methylated Stool DNA among Subgroups

    SFRP2TFPI2NDRG4BMP3Combinationa
    Colorectal cancer (n=35)
     No. of positive results2111241433
     Sensitivity (%)60.031.468.840.094.3
     95% CI43.0–77.015.0–48.052.0–85.023.0–57.086.2–100.0
    Advanced adenoma (n=36)
     No. of positive results1010101226
     Sensitivity (%)27.827.827.833.372.2
     95% CI12.4–43.212.4–43.212.4–43.217.2–49.543.0–77.0
    Normal (n=40)
     No. of positive results548618
     Specificity (%)87.590.080.085.055.0
     95% CI76.8–98.280.3–99.767.0–92.973.4–96.538.9–71.1

    aHypermethylation of 1 of the 4 promoters (SFRP2, TFPI2, NDRG4, and BMP3).

    SFRP2, secreted frizzled-related protein 2; TFPI2, tissue factor pathway inhibitor 2; NDRG4, N-myc downstream-regulated gene 4; BMP3, bone morphogenetic protein 3.

    Correlation between Clinicopathologic Findings and Sensitivity of Methylated Stool DNA

    No.MSPaSensitivity (%)bP-value
    Colorectal cancer35
     Location0.99
      Right121191.7
      Left232295.7
     Stage0.23
      I/II171588.2
      III/IV1818100.0
    Advanced adenoma36
     Size (mm)0.28
      >10352674.3
      ≤10100
     Histology0.68
      Villous272074.1
      Tubular9666.7
     Dysplasia0.37
      High grade7457.1
      Low grade292275.9

    aHypermethylation of 1 of the 4 promoters (SFRP2, TFPI2, NDRG4, and BMP3).

    bCombination of 4 promoters (SFRP2, TFPI2, NDRG4, and BMP3).

    MSP, methylation-specific PCR; SFRP2, secreted frizzled-related protein 2; TFPI2, tissue factor pathway inhibitor 2; NDRG4, N-myc downstream-regulated gene 4; BMP3, bone morphogenetic protein 3.

    Table 1 Primer Sequences, PCR Product Sizes, and Annealing Temperatures Used in MSP Assays

    MSP, methylation-specific PCR; SFRP2, secreted frizzled-related protein 2; M, methylated; S, sense; A, antisense; U, unmethylated; BMP3, bone morphogenetic protein 3; NDRG4, N-myc downstream-regulated gene 4; TFPI2, tissue factor pathway inhibitor 2.

    Table 2 Characteristics of the Patients Enrolled in the Study

    Values are presented as number (%) or mean±SD.

    Table 3 Sensitivity and Specificity of Methylated Stool DNA among Subgroups

    aHypermethylation of 1 of the 4 promoters (SFRP2, TFPI2, NDRG4, and BMP3).

    SFRP2, secreted frizzled-related protein 2; TFPI2, tissue factor pathway inhibitor 2; NDRG4, N-myc downstream-regulated gene 4; BMP3, bone morphogenetic protein 3.

    Table 4 Correlation between Clinicopathologic Findings and Sensitivity of Methylated Stool DNA

    aHypermethylation of 1 of the 4 promoters (SFRP2, TFPI2, NDRG4, and BMP3).

    bCombination of 4 promoters (SFRP2, TFPI2, NDRG4, and BMP3).

    MSP, methylation-specific PCR; SFRP2, secreted frizzled-related protein 2; TFPI2, tissue factor pathway inhibitor 2; NDRG4, N-myc downstream-regulated gene 4; BMP3, bone morphogenetic protein 3.


    Intest Res : Intestinal Research
    Close layer
    TOP